Displaying publications 41 - 60 of 130 in total

Abstract:
Sort:
  1. Wahab AA, Mohamed N, Ding CH, Muttaqillah NAS, Rosli N, Mohammed F
    Trop Biomed, 2023 Mar 01;40(1):23-28.
    PMID: 37356000 DOI: 10.47665/tb.40.1.008
    Mycotic aneurysm is one of the extra-intestinal manifestations of Salmonella Enteritidis infection. The diagnosis of this condition is challenging owed to its variation in clinical presentations. We presented a case of a 54-year-old man with underlying diabetes mellitus and chronic smokers presented with acute right flank pain and fever associated with mild jaundice. The initial laboratory investigations suggested features of obstructive jaundice and urinary tract infection. The contrast enhancing computed tomography of the abdomen revealed the presence of saccular mycotic aneurysm located at the infrarenal abdominal aorta. The blood culture grew Salmonella Enteritidis which was susceptible to ceftriaxone, trimethoprim-sulfamethoxazole, ciprofloxacin, ampicillin, and amoxicillin-clavulanic acid. Intravenous ceftriaxone was initiated, and he underwent open surgery and artery repair at day 8 of admission. He responded well to the treatment given and subsequently discharged home after completed three weeks of intravenous ceftriaxone.
  2. Jayusman PA, Mohamed IN, Alias E, Mohamed N, Shuid AN
    Nutrients, 2018 Jun 21;10(7).
    PMID: 29933617 DOI: 10.3390/nu10070799
    Male osteoporosis is associated with higher rates of disability and mortality. Hence the search for suitable intervention and treatment to prevent the degeneration of skeletal health in men is necessary. Eurycoma longifolia (EL), a traditional plant with aphrodisiac potential may be used to treat and prevent male osteoporosis. The skeletal protective effect of quassinoid-rich EL extract, which has a high content of eurycomanone, has not been studied. This study aimed to determine whether EL could prevent skeletal deteriorations in gonadal hormone-deficient male rats. Ninety-six male Sprague⁻Dawley rats were randomly assigned to baseline, sham-operated (Sham), orchidectomised or chemically castrated groups. Chemical castration was achieved via subcutaneous injection of degarelix at 2 mg/kg. The orchidectomised and degarelix-castrated rats were then divided into negative control groups (ORX, DGX), testosterone-treated groups (intramuscular injection at 7 mg/kg weekly) (ORX + TES, DGX + TES), and EL-supplemented groups receiving daily oral gavages at doses of 25 mg/kg (ORX + EL25, DGX + EL25), 50 mg/kg (ORX + EL50, DGX + EL50), and 100 mg/kg (ORX + EL100, DGX + EL100). Following 10 weeks of treatment, the rats were euthanized and their blood and femora were collected. Bone biochemical markers, serum testosterone, osteoprotegerin (OPG), and receptor activator of nuclear factor kappa β-ligand (RANKL) levels and histomorphometric indices were evaluated. Quassinoid-rich EL supplementation was found to reduce degenerative changes of trabecular structure by improving bone volume, trabecular number, and separation. A reduction in the percentage of osteoclast and increase in percentage of osteoblast on bone surface were also seen with EL supplementation. Dynamic histomorphometric analysis showed that the single-labeled surface was significantly decreased while the double-labeled surface was significantly increased with EL supplementations. There was a marginal but significant increase in serum testosterone levels in the ORX + EL25, DGX + EL50, and DGX + EL100 groups compared to their negative control groups. Quassinoid-rich EL extract was effective in reducing skeletal deteriorations in the androgen-deficient osteoporosis rat model.
  3. Razali N, Dewa A, Asmawi MZ, Mohamed N, Manshor NM
    J Integr Med, 2020 Jan;18(1):46-58.
    PMID: 31882255 DOI: 10.1016/j.joim.2019.12.003
    OBJECTIVE: To evaluate vasorelaxant and vasoconstriction effects of Zingiber officinale var. rubrum (ZOVR) on live rats and isolated aortic rings of spontaneously hypertensive rats (SHRs).

    METHODS: Extracts of ZOVR were subjected to in-vivo antihypertensive screening using noninvasive blood pressures in SHRs. The most potent extract, ZOVR petroleum ether extract (ZOP) was then fractionated using n-hexane, chloroform and water. Isolated thoracic aortic rings were harvested and subjected to vascular relaxation studies of n-hexane fraction of ZOP (HFZOP) with incubation of different antagonists such as Nω-nitro-l-arginine methyl ester (L-NAME, 10 µmol/L), indomethacin (10 µmol/L), methylene blue (10 µmol/L), atropine (1 µmol/L), glibenclamide (10 µmol/L), prazosin (0.01 µmol/L), and propranolol (1 µmol/L).

    RESULTS: During the screening of various ZOVR extracts, ZOP produced the most reduction in blood pressures of SHRs and so did HFZOP. HFZOP significantly decreased phenylephrine-induced contraction and enhanced acetylcholine-induced relaxation. L-NAME, indomethacin, methylene blue, atropine, and glibenclamide significantly potentiated the vasorelaxant effects of HFZOP. Propranolol and prazosin did not alter the vasorelaxant effects of HFZOP. HFZOP significantly suppressed the Ca2+-dependent contraction and influenced the ratio of the responses to phenylephrine in Ca2+-free medium.

    CONCLUSION: This study demonstrates that ZOP may exert an antihypertensive effect in the SHR model. Its possible vascular relaxation mechanisms involve nitric oxide and prostacyclin release, activation of cGMP-KATP channels, stimulation of muscarinic receptors, and transmembrane calcium channel or Ca2+ release from intracellular stores. Possible active compounds that contribute to the vasorelaxant effects are 6-gingerol, 8-gingerol and 6-shogaol.

  4. Muhammad N, Luke DA, Shuid AN, Mohamed N, Soelaiman IN
    PMID: 23118785 DOI: 10.1155/2012/161527
    Postmenopausal osteoporotic bone loss occurs mainly due to cessation of ovarian function, a condition associated with increased free radicals. Vitamin E, a lipid-soluble vitamin, is a potent antioxidant which can scavenge free radicals in the body. In this study, we investigated the effects of alpha-tocopherol and pure tocotrienol on bone microarchitecture and cellular parameters in ovariectomized rats. Three-month-old female Wistar rats were randomly divided into ovariectomized control, sham-operated, and ovariectomized rats treated with either alpha-tocopherol or tocotrienol. Their femurs were taken at the end of the four-week study period for bone histomorphometric analysis. Ovariectomy causes bone loss in the control group as shown by reduction in both trabecular volume (BV/TV) and trabecular number (Tb.N) and an increase in trabecular separation (Tb.S). The increase in osteoclast surface (Oc.S) and osteoblast surface (Ob.S) in ovariectomy indicates an increase in bone turnover rate. Treatment with either alpha-tocopherol or tocotrienol prevents the reduction in BV/TV and Tb.N as well as the increase in Tb.S, while reducing the Oc.S and increasing the Ob.S. In conclusion, the two forms of vitamin E were able to prevent bone loss due to ovariectomy. Both tocotrienol and alpha-tocopherol exert similar effects in preserving bone microarchitecture in estrogen-deficient rat model.
  5. Abukhadir SS, Mohamed N, Makpol S, Muhammad N
    PMID: 23049610 DOI: 10.1155/2012/656025
    The study determines the effects of palm vitamin E on the gene expression of bone-formation-related genes in nicotine-treated rats. Male rats were divided into three groups: normal saline olive oil (NSO), nicotine olive oil (NO), and nicotine palm vitamin E (NE). The treatment was carried out in 2 phases. During the first 2 months, the NSO group received normal saline while the NO and NE groups received nicotine 7 mg/kg, 6 days a week, intraperitoneally. The following 2 months, normal saline and nicotine administration was stopped and was replaced with oral supplementation of olive oil for the NSO and NO groups and oral supplementation of palm vitamin E (60 mg/kg) for the NE group. Both femurs were harvested to determine the gene expression of bone morphogenetic protein-2 (BMP-2), Osterix (OSX), and Runt-related transcription factor 2 (RUNX2). Nicotine significantly downregulated the gene expression. This effect was reversed by palm vitamin E treatment. In conclusion, palm vitamin E may play a role in osteoblast differentiation and can be considered as an anabolic agent to treat nicotine-induced osteoporosis.
  6. Hayatullina Z, Muhammad N, Mohamed N, Soelaiman IN
    PMID: 23024690
    Oxidative stress and free radicals have been implicated in the pathogenesis of osteoporosis. Therefore, antioxidant compounds have the potential to be used in the prevention and treatment of the disease. In this study, we investigated the effects of virgin coconut oil (VCO) on bone microarchitecture in a postmenopausal osteoporosis rat model. VCO is a different form of coconut oil as it is rich with antioxidants. Three-month-old female rats were randomly grouped into baseline, sham-operated, ovariectomized control (Ovx), and ovariectomized rats fed with 8% VCO in their diet for six weeks (Ovx+VCO). Bone histomorphometry of the right femora was carried out at the end of the study. Rats supplemented with VCO had a significantly greater bone volume and trabecular number while trabecular separation was lower than the Ovx group. In conclusion, VCO was effective in maintaining bone structure and preventing bone loss in estrogen-deficient rat model.
  7. Fathilah SN, Abdullah S, Mohamed N, Shuid AN
    PMID: 22991574
    Estrogen replacement therapy (ERT) is the main treatment postmenopausal osteoporosis. However, ERT causes serious side effects, such as cancers and thromboembolic problems. Labisia pumila var. alata (LPva) is a herb with potential as an alternative to ERT to prevent complications of osteoporosis, especially fragility fractures. This study was conducted to determine the effects of LPva on the biomechanical strength of femora exposed to osteoporosis due to estrogen deficiency, using the postmenopausal rat model. Thirty-two female rats were randomly divided into four groups: Sham-operated (Sham), ovariectomized control (OVXC), ovariectomized with Labisia pumila var. alata (LP), and ovariectomized with ERT (Premarin) (ERT). The LPva and ERT were administered via oral gavage daily at doses of 17.5 mg/kg and 64.5 μg/kg, respectively. Following two months of treatment, the rats were euthanized, and their right femora were prepared for bone biomechanical testing. The results showed that ovariectomy compromised the femoral strength, while LPva supplementation to the ovariectomized rats improved the femoral strength. Therefore, LPva may be as effective as ERT in preventing fractures due to estrogen-deficient osteoporosis.
  8. Mohd Effendy N, Mohamed N, Muhammad N, Mohamad IN, Shuid AN
    PMID: 22973408 DOI: 10.1155/2012/938574
    Osteoporosis which is characterized by low bone mass and microarchitectural deterioration with a consequent increase in bone fragility can be associated with various stimuli such as oxidative stress and inflammation. Postmenopausal women are more prone to osteoporosis due to reduction in estrogen which may further lead to elevation of oxidative stress and lipid accumulation which will promote osteoblasts apoptosis. Proinflammatory cytokines are elevated following estrogen deficiency. These cytokines are important determinants of osteoclasts differentiation and its bone resorption activity. The main treatment for postmenopausal osteoporosis is estrogen replacement therapy (ERT). Despite its effectiveness, ERT, however, can cause many adverse effects. Therefore, alternative treatment that is rich in antioxidant and can exert an anti-inflammatory effect can be given to replace the conventional ERT. Tualang honey is one of the best options available as it contains antioxidant as well as exerting anti-inflammatory effect which can act as a free radical scavenger, reducing the oxidative stress level as well as inhibiting proinflammatory cytokine. This will result in survival of osteoblasts, reduced osteoclastogenic activity, and consequently, reduce bone loss. Hence, Tualang honey can be used as an alternative treatment of postmenopausal osteoporosis with minimal side effects.
  9. Muhammad N, Luke DA, Shuid AN, Mohamed N, Soelaiman IN
    Clinics (Sao Paulo), 2013 Oct;68(10):1338-43.
    PMID: 24212841 DOI: 10.6061/clinics/2013(10)08
    OBJECTIVE: Accelerated bone loss that occurs in postmenopausal women has been linked to oxidative stress and increased free radicals. We propose the use of antioxidants to prevent and reverse postmenopausal osteoporosis. This study aimed to examine the effects of tocotrienol, a vitamin E analog, on bone loss due to estrogen deficiency. Our previous study showed that tocotrienol increased the trabecular bone volume and trabecular number in ovariectomized rats. In the current study, we investigated the effects of tocotrienol supplementation on various biochemical parameters in a postmenopausal osteoporosis rat model.

    MATERIALS AND METHODS: A total of 32 female Wistar rats were randomly divided into four groups. The baseline group was sacrificed at the start of the study, and another group was sham operated. The remaining rats were ovariectomized and either given olive oil as a vehicle or treated with tocotrienol at a dose of 60 mg/kg body weight. After four weeks of treatment, blood was withdrawn for the measurement of interleukin-1 (IL1) and interleukin-6 (IL6) (bone resorbing cytokines), serum osteocalcin (a bone formation marker) and pyridinoline (a bone resorption marker).

    RESULTS: Tocotrienol supplementation in ovariectomized rats significantly reduced the levels of osteocalcin, IL1 and IL6. However, it did not alter the serum pyridinoline level.

    CONCLUSION: Tocotrienol prevented osteoporotic bone loss by reducing the high bone turnover rate associated with estrogen deficiency. Therefore, tocotrienol has the potential to be used as an anti-osteoporotic agent in postmenopausal women.

  10. Tan JA, Chin SS, Ong GB, Mohamed Unni MN, Soosay AE, Gudum HR, et al.
    Public Health Genomics, 2015;18(1):60-4.
    PMID: 25412720 DOI: 10.1159/000368342
    BACKGROUND: Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak.
    METHODS: Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing.
    RESULTS: Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients.
    CONCLUSION: The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations.
  11. Gomaa MN, Soliman K, Ayesh A, Abd El-Wahed A, Hamza Z, Mansour HM, et al.
    Nat Prod Res, 2016;30(6):729-34.
    PMID: 26186031 DOI: 10.1080/14786419.2015.1040991
    The marine soft corals Sarcophyton trocheliophorum crude extracts possessed antimicrobial activity towards pathogenic bacterial strains, i.e. Bacillus cereus, Salmonella typhi, Escherichia coli, Staphylococcus aureus and Pseudomonas aeruginosa. Bioassay-guided fractionation indicated that the antimicrobial effect was due to the presence of terpenoid bioactive derivatives. Further biological assays of the n-hexane fractions were carried out using turbidity assay, inhibition zone assay and minimum inhibitory concentration for investigating the growth-inhibition effect towards the Gram-positive and Gram-negative bacteria. The fractions were screened and the structure of the isolated compound was justified by interpretation of the spectroscopic data, mainly mass spectrometry (GC-MS). The structure was assigned as (5S)-3-[(3E,5S)-5-hydroxy-3-hepten-6-yn-1-yl]-5-methyl-2(5H)-furanone and was effective at concentrations as low as 0.20 mg/mL. The above findings, in the course of our ongoing research on marine products, may implicate that the profound anti-microbial activity of the S. trocheliophorum soft corals, inhabiting the red sea reefs, is attributed to the presence of growth-inhibiting secondary metabolites mainly terpenoids.
  12. Mohamed NA, Ramli S, Amin NN, Sulaiman WS, Isahak I, Jamaluddin TZ, et al.
    Med J Malaysia, 2016 04;71(2):62-5.
    PMID: 27326943 MyJurnal
    INTRODUCTION: Nasal colonisation of S. aureus in healthy children was 18% to 30%. One to three percent of them were colonised by Methicillin-resistant Staphlycoccus aureus (MRSA). Although MRSA infection has become increasingly reported, population-based S. aureus and MRSA colonisation estimates are lacking. The main objective of this study was to determine the prevalence of S. aureus carriage among children.

    METHODS: Nasal samples for S. aureus culture were obtained from 250 children from three kindergartens in the Klang Valley, after consent was obtained from the children and their parents. Swabs were transported in Stuart medium, and inoculated on mannitol-salt agar within four hours of collection. Identification and disk diffusion test were done according to guidelines. Polymerase chain reaction was done on MRSA isolates for the presence of mecA and lukS/FPV genes.

    RESULTS: Overall prevalence of S. aureus and MRSA carriage were 19.2% (48/250) and 1.6% (4/250) respectively. mecA gene was present in all isolates, 50% isolates carried Panton-Valentine leucocidin (PVL) gene. Sccmec type I was found in 2 isolates and the remaining isolates has Sccmec type V.

    CONCLUSION: The prevalence of S. aureus and MRSA carriage were similar to other studies. However, risk of contracting severe infection might be higher due to presence of PVL gene in half of the MRSA isolates.
  13. Salim SS, Mustafa MB, Asemi A, Ahmad A, Mohamed N, Ghazali KB
    Res Dev Disabil, 2016 Sep;56:41-59.
    PMID: 27262125 DOI: 10.1016/j.ridd.2016.05.013
    BACKGROUND: The speech pronunciation practice (SPP) system enables children with speech impairments to practise and improve their speech pronunciation. However, little is known about the surrogate measures of the SPP system.

    AIMS: This research aims to measure the success and effectiveness of the SPP system using three surrogate measures: usage (frequency of use), performance (recognition accuracy) and satisfaction (children's subjective reactions), and how these measures are aligned with the success of the SPP system, as well as to each other.

    METHODS AND PROCEDURES: We have measured the absolute change in the word error rate (WER) between the pre- and post-training, using the ANOVA test. Correlation co-efficiency (CC) analysis was conducted to test the relation between the surrogate measures, while a Structural Equation Model (SEM) was used to investigate the causal relations between the measures.

    OUTCOMES AND RESULTS: The CC test results indicate a positive correlation between the surrogate measures. The SEM supports all the proposed gtheses. The ANOVA results indicate that SPP is effective in reducing the WER of impaired speech.

    CONCLUSIONS AND IMPLICATIONS: The SPP system is an effective assistive tool, especially for high levels of severity. We found that performance is a mediator of the relation between "usage" and "satisfaction".

  14. Yusuf M, Mohamed N, Mohamad S, Janezic D, Damodaran KV, Wahab HA
    J Chem Inf Model, 2016 Jan 25;56(1):82-100.
    PMID: 26703840 DOI: 10.1021/acs.jcim.5b00331
    Increased reports of oseltamivir (OTV)-resistant strains of the influenza virus, such as the H274Y mutation on its neuraminidase (NA), have created some cause for concern. Many studies have been conducted in the attempt to uncover the mechanism of OTV resistance in H274Y NA. However, most of the reported studies on H274Y focused only on the drug-bound system, so the direct effects of the mutation on NA itself prior to drug binding still remain unclear. Therefore, molecular dynamics simulations of NA in apo form, followed by principal component analysis and interaction energy calculations, were performed to investigate the structural changes of the NA binding site as a result of the H274Y mutation. It was observed that the disruption of the NA binding site due to the H274Y mutation was initiated by the repulsive effect of Y274 on the 250-loop, which in turn altered the hydrogen-bonding network around residue 274. The rotated W295 side chain caused the upward movement of the 340-loop. Consequently, sliding box docking results suggested that the binding pathway of OTV was compromised because of the disruption of this binding site. This study also highlighted the importance of the functional group at C6 of the sialic acid mimicry. It is hoped that these results will improve the understanding of OTV resistance and shed some light on the design of a novel anti-influenza drug.
  15. Yaacob JS, Mahmad N, Mat Taha R, Mohamed N, Mad Yussof AI, Saleh A
    ScientificWorldJournal, 2014;2014:262710.
    PMID: 24977187 DOI: 10.1155/2014/262710
    Various explants (stem, leaf, and root) of Citrus assamensis were cultured on MS media supplemented with various combinations and concentrations (0.5-2.0 mg L(-1)) of NAA and BAP. Optimum shoot and root regeneration were obtained from stem cultures supplemented with 1.5 mg L(-1) NAA and 2.0 mg L(-1) BAP, respectively. Explant type affects the success of tissue culture of this species, whereby stem explants were observed to be the most responsive. Addition of 30 gL(-1) sucrose and pH of 5.8 was most optimum for in vitro regeneration of this species. Photoperiod of 16 hours of light and 8 hours of darkness was most optimum for shoot regeneration, but photoperiod of 24 hours of darkness was beneficial for production of callus. The morphology (macro and micro) and anatomy of in vivo and in vitro/ex vitro Citrus assamensis were also observed to elucidate any irregularities (or somaclonal variation) that may arise due to tissue culture protocols. Several minor micromorphological and anatomical differences were observed, possibly due to stress of tissue culture, but in vitro plantlets are expected to revert back to normal phenotype following full adaptation to the natural environment.
  16. Shah I, Adnan R, Ngah WS, Mohamed N, Taufiq-Yap YH
    Bioresour Technol, 2014 May;160:52-6.
    PMID: 24630369 DOI: 10.1016/j.biortech.2014.02.047
    To enhance the potential of activated carbon (AC), iron incorporation into the AC surface was examined in the present investigations. Iron doped activated carbon (FeAC) material was synthesized and characterized by using surface area analysis, energy dispersive X-ray (EDX), temperature programmed reduction (TPR) and temperature programmed desorption (TPD). The surface area of FeAC (543 m(2)/g) was found to be lower than AC (1043 m(2)/g) as a result of the pores widening due to diffusion of iron particles into the porous AC. Iron uploading on AC surface was confirmed through EDX analysis, showing up to 13.75 wt.% iron on FeAC surface. TPR and TPD profiles revealed the presence of more active sites on FeAC surface. FeAC have shown up to 98% methylene blue (MB) removal from the aqueous media. Thermodynamic parameters indicated the spontaneous and exothermic nature of the sorption processes.
  17. Mohamed NA, Zainol Rashid Z, Wong KK, S A A, Rahman MM
    Pak J Med Sci, 2013 Sep;29(5):1142-6.
    PMID: 24353708
    Hepatitis C virus (HCV) genotyping is important for treatment and epidemiological purposes. The objective was to determine HCV genotype and their associations with certain risk factors at University Kebangsaan Malaysia Medical Centre (UKMMC).
  18. Mustafa MB, Salim SS, Mohamed N, Al-Qatab B, Siong CE
    PLoS One, 2014;9(1):e86285.
    PMID: 24466004 DOI: 10.1371/journal.pone.0086285
    Automatic speech recognition (ASR) is currently used in many assistive technologies, such as helping individuals with speech impairment in their communication ability. One challenge in ASR for speech-impaired individuals is the difficulty in obtaining a good speech database of impaired speakers for building an effective speech acoustic model. Because there are very few existing databases of impaired speech, which are also limited in size, the obvious solution to build a speech acoustic model of impaired speech is by employing adaptation techniques. However, issues that have not been addressed in existing studies in the area of adaptation for speech impairment are as follows: (1) identifying the most effective adaptation technique for impaired speech; and (2) the use of suitable source models to build an effective impaired-speech acoustic model. This research investigates the above-mentioned two issues on dysarthria, a type of speech impairment affecting millions of people. We applied both unimpaired and impaired speech as the source model with well-known adaptation techniques like the maximum likelihood linear regression (MLLR) and the constrained-MLLR(C-MLLR). The recognition accuracy of each impaired speech acoustic model is measured in terms of word error rate (WER), with further assessments, including phoneme insertion, substitution and deletion rates. Unimpaired speech when combined with limited high-quality speech-impaired data improves performance of ASR systems in recognising severely impaired dysarthric speech. The C-MLLR adaptation technique was also found to be better than MLLR in recognising mildly and moderately impaired speech based on the statistical analysis of the WER. It was found that phoneme substitution was the biggest contributing factor in WER in dysarthric speech for all levels of severity. The results show that the speech acoustic models derived from suitable adaptation techniques improve the performance of ASR systems in recognising impaired speech with limited adaptation data.
  19. Nambiar P, John J, Al-Amery SM, Purmal K, Chai WL, Ngeow WC, et al.
    ScientificWorldJournal, 2013;2013:213757.
    PMID: 24348143 DOI: 10.1155/2013/213757
    Orangutans are believed to have close biological affinities to humans. Teeth being the hardest tissue provide useful information on primate evolution. Furthermore, knowledge of the pulp chamber and root canal morphology is important for dental treatment. A female Bornean orangutan and a Sumatran male orangutan skull were available for this study. Both of their dentitions, comprising 50 teeth, were scanned employing the cone-beam computed tomography for both metrical and nonmetrical analyses. Measurements included tooth and crown length, root length, enamel covered crown height, root canal length (posterior teeth), length of pulpal space (anterior teeth), and root canal width. Nonmetrical parameters included number of canals per root, number of foramina in each root, and root canal morphology according to Vertucci's classification. It was found that the enamel covered crown height was the longest in the upper central incisors although the canine was the longest amongst the anterior teeth. Both the upper premolars were three-rooted while the lower second premolar of the Sumatran orangutan was two-rooted, with two foramina. The mandibular lateral incisors of the Bornean orangutan were longer than the central incisors, a feature similar to humans. In addition, secondary dentine deposition was noticed, a feature consistent with aged humans.
Filters
Contact Us

Please provide feedback to Administrator (afdal@afpm.org.my)

External Links