MyMedR

Displaying publications 61 - 80 of 84 in total

Abstract:

Sort:

Mesenchymal stem cells of human placenta and umbilical cord suppress T-cell proliferation at G0 phase of cell cycle

Vellasamy S, Sandrasaigaran P, Vidyadaran S, Abdullah M, George E, Ramasamy R

Cell Biol Int, 2013 Mar;37(3):250-6.
PMID: 23364902 DOI: 10.1002/cbin.10033

Mesenchymal stem cells (MSC) generated from human umbilical cord (UC-MSC) and placenta (PLC-MSC) were assessed and compared for their immunomodulatory function on T cells proliferation by analysis of the cell cycle. Mitogen stimulated or resting T cells were co-cultured in the presence or absence of MSC. T-cell proliferation was assessed by tritiated thymidine ((3) H-TdR) assay and the mechanism of inhibition was examined bycell cycle and apoptosis assay. Both UC-MSC and PLC-MSC profoundly inhibited the proliferation of T-cell, mainly via cell-to-cell contact. MSC-mediated anti-proliferation does not lead to apoptosis,but prevented T cells from entering S phase and they therefore accumulated in the G(0) /G(1) phases. The anti-proliferative activity of MSC was related to this cell cycle arrest of T-cell. UC-MSC produced a greater inhibition than PLC-MSC in all measured parameters.
Two novel polyadenylation mutations leading to beta(+)-thalassemia

Jankovic L, Efremov GD, Petkov G, Kattamis C, George E, Yang KG, et al.

Br J Haematol, 1990 May;75(1):122-6.
PMID: 2375910

In an ongoing effort to identify point mutations causing beta-thalassaemia, we have found two previously unreported mutations which are located in the Poly A site of the beta-globin gene. The screening programme used amplified DNA and dot-blot hybridization with several 32P-labelled oligonucleotide probes. DNA samples which remained unidentified by this methodology were subjected to sequencing with 32P-labelled primers and modified T7 DNA polymerase. The newly discovered mutations were confirmed by the dot-blot hybridization technique. One type concerned an AATAAA----AATGAA mutation in the polyadenylation site and was found in one family from Yugoslavia (including one patient with the C----T mutation at codon 29 in trans), one from Bulgaria (the patient had the G----A mutation at IVS-I-110 in trans), and one from Greece (this patient had the C----G mutation at IVS-II-745 in trans). Haematological data for three simple heterozygotes suggested a rather mild beta(+)-thalassemia. The second type involved an AATAAA----AATAGA mutation and was found in one family from Malaysia. The propositus had the beta E mutation on the other chromosome, was originally diagnosed as mild Hb E-beta(+)-thalassaemia, and had Hb A and Hb E percentages which were nearly the same.
Molecular characterization of beta-globin gene mutations in Malay patients with Hb E-beta-thalassaemia and thalassaemia major

Yang KG, Kutlar F, George E, Wilson JB, Kutlar A, Stoming TA, et al.

Br J Haematol, 1989 May;72(1):73-80.
PMID: 2736244

This study concerned the identification of the beta-thalassaemia mutations that were present in 27 Malay patients with Hb E-beta-thalassaemia and seven Malay patients with thalassaemia major who were from West Malaysia. Nearly 50% of all beta-thalassaemia chromosomes carried the G----C substitution at nucleotide 5 of IVS-I; the commonly occurring Chinese anomalies such as the frameshift at codons 41 and 42, the nonsense mutation A----T at codon 17, the A----G substitution at position -28 of the promoter region, and the C----T substitution at position 654 of the second intron, were rare or absent. Two new thalassaemia mutations were discovered. The first involves a frameshift at codon 35 (-C) that was found in two patients with Hb E-beta zero-thalassaemia and causes a beta zero-thalassaemia because a stop codon is present at codon 60. The second is an AAC----AGC mutation in codon 19 that was present on six chromosomes. This substitution results in the production of an abnormal beta chain (beta-Malay) that has an Asn----Ser substitution at position beta 19. Hb Malay is a 'Hb Knossos-like' beta +-thalassaemia abnormality; the A----G mutation at codon 19 likely creates an alternate splicing site between codons 17 and 18, reducing the efficiency of the normal donor splice site at IVS-I to about 60%.
Rapid detection of α-thalassaemia variants using droplet digital PCR

Lee TY, Lai MI, Ramachandran V, Tan JA, Teh LK, Othman R, et al.

Int J Lab Hematol, 2016 Aug;38(4):435-43.
PMID: 27349818 DOI: 10.1111/ijlh.12520

INTRODUCTION: Alpha thalassaemia is a highly prevalent disease globally and is a well-known public health problem in Malaysia. The deletional forms of the mutation are the most common forms found in alpha thalassaemia. The three most common deletional alpha thalassaemia found in this region include --(SEA) deletion, -α(3.7) rightward and -α(4.2) leftward deletions. The prevalence rate of triplication alpha cases such as ααα(anti3.7) and ααα(anti4.2) is not known in Malaysia although it plays a role in exacerbating the clinical phenotypes in beta thalassaemia carriers. Recently, there have been more reported cases of rare alpha thalassaemia mutations due to the advancement of molecular techniques involved in thalassaemia detections. Therefore, it is essential to develop a new method which allows the detection of different alpha thalassaemia mutations including the rare ones simultaneously and accurately.
METHODS: The purpose of this study was to design an assay for the detection of triplications, common and rare deletional alpha thalassaemia using droplet digital PCR (ddPCR).
RESULTS: This is a quantitative detection method to measure the changes of copy number which can detect deletions, duplications and triplications of the alpha globin gene simultaneously.
CONCLUSION: In conclusion, ddPCR is an alternative method for rapid detection of alpha thalassaemia variants in Malaysia.
Fulltext Prevalence of dyslipidaemia in type 2 diabetes mellitus patients and Its association to diabetic retinopathy in a Malaysian tertiary hospital

Samsudin IN, Md Saleh R, Thambiah SC, Mohamad Amir Hamzah AS, Wan Khalik WNF, George E

Malaysian Journal of Medicine and Health Sciences, 2014;10(2):47-51.
MyJurnal

Background: Diabetic retinopathy (DR) is a microvascular complication of diabetes, which is a cause of visual impairment and blindness. Its development and progression have been linked to dyslipidaemia, although the link remains inconclusive.
Aim: This study aimed to determine the prevalence of dyslipidaemia among type 2 diabetic patients with DR in a tertiary setting and to determine the association between dyslipidaemia and DR severity.
Materials and methods: This was a cross sectional study using retrospective data of type 2 diabetic patients attending the opthalmology clinic of a tertiary centre from January 2007 to June 2014. Results of their fasting lipid profile and clinical data were retrieved from the hospital information system.
Results: A total of 178 patient’s data were collected. 120 (n=67.4%) patients had non-proliferative diabetic retinopathy (NDPR) with moderate NPDR being the most prevalent. Dyslipidaemia was noted in 151 (84.8%) of the patients. Patients had a combination of more than one abnormality in the lipid profile with increased LDL-cholesterol being the main abnormality. Dyslipidaemia was however, not significantly associated with DR severity.
Conclusion: Dyslipidaemia was highly prevalent in DR patients. The dyslipidaemia was however not associated with severity of DR.
Study site: Ophthalmology clinic, Hospital (?name), Malaysia
Fulltext Secondary polycythaemia in a Malay girl with homozygous Hb Tak

Amran HS, Aziz MA, George E, Mahmud N, Lee TY, Md Noor S

Malays J Pathol, 2017 Dec;39(3):321-326.
PMID: 29279598 MyJurnal

Hb Tak is one of more than 200 high affinity haemoglobin variants reported worldwide. It results from the insertion of two nucleotides (AC) at the termination codon, between codon 146 and codon 147 of the beta-globin gene [Beta 147 (+AC)]. Polycythaemia is the main clinical feature although affected carriers are usually asymptomatic and do not require intervention. Several case studies in this region have reported the co-inheritance of Hb Tak with Hb E, delta beta and beta thalassaemia with one case of homozygous Hb Tak in a Thai boy. In this case report, a cluster of haemoglobin Tak was found in a family of Malay ethnic origin. Cascade family screening was conducted while investigating a 4-year old girl who presented with symptomatic polycythaemia. She had 2 previous Hb analysis done, at 7-month and 2-year-old with the diagnosis of possible Hb Q Thailand and Homozygous Hb D, respectively. Both diagnosis did not fit her clinical presentations. She was plethoric, had reduced exercise tolerance as well as cardiomyopathy. Her parents were consanguineously married and later diagnosed as asymptomatic carriers of Hb Tak. Consequently, re-analysis of the girl's blood sample revealed a homozygous state of Hb Tak. In conclusion, high oxygen affinity haemoglobin like Hb Tak should be considered in the investigation of polycythaemic patients with abnormal Hb analyses. In this case, DNA analysis was crucial in determining the correct diagnosis.
Thalassemia intermedia in HbH-CS disease with compound heterozygosity for beta-thalassemia: challenges in hemoglobin analysis and clinical diagnosis

Tan JA, Kok JL, Tan KL, Wee YC, George E

Genes Genet Syst, 2009 Feb;84(1):67-71.
PMID: 19420802

Co-inheritance of alpha-thalassemia with homozygosity or compound heterozygosity for beta-thalassemia may ameliorate beta-thalassemia major. A wide range of clinical phenotypes is produced depending on the number of alpha-thalassemia alleles (-alpha/alphaalpha --/alphaalpha, --/-alpha). The co-inheritance of beta-thalassemia with alpha-thalassemia with a single gene deletion (-alpha/alphaalpha) is usually associated with thalassemia major. In contrast, the co-inheritance of beta-thalassemia with two alpha-genes deleted in cis or trans (--/alphaalpha or -alpha/-alpha) generally produces beta-thalassemia intermedia. In Southeast Asia, the most common defect responsible for alpha-thalassemia is the Southeast Asian (SEA) deletion of 20.5 kilobases. The presence of the SEA deletion with Hb Constant Spring (HbCS) produces HbH-CS disease. Co-inheritance of HbH-CS with compound heterozygosity for beta-thalassemia is very rare. This study presents a Malay patient with HbH-CS disorder and beta degrees/beta+-thalassemia. The SEA deletion was confirmed in the patient using a duplex-PCR. A Combine-Amplification Refractory Mutation System (C-ARMS) technique to simultaneously detect HbCS and Hb Quong Sze confirmed HbCS in the patient. Compound heterozygosity for CD41/42 and Poly A was confirmed using the ARMS. This is a unique case as the SEA alpha-gene deletion in cis (--SEA/alphaalpha) is generally not present in the Malays, who more commonly possess the two alpha-gene deletion in trans (-alpha/-alpha). In addition, the beta-globin gene mutation at CD41/42 is a common mutation in the Chinese and not in the Malays. The presence of both the SEA deletion and CD41/42 in the mother of the patient suggests the possible introduction of these two defects into the family by marriage with a Chinese.
Molecular defects in the beta-globin gene identified in different ethnic groups/populations during prenatal diagnosis for beta-thalassemia: a Malaysian experience

Tan JA, George E, Tan KL, Chow T, Tan PC, Hassan J, et al.

Clin Exp Med, 2004 Dec;4(3):142-7.
PMID: 15599663 DOI: 10.1007/s10238-004-0048-x

Beta-thalassemia is the most-common genetic disorder of hemoglobin synthesis in Malaysia, and about 4.5% of the population are heterozygous carriers of the disorder. Prenatal diagnosis was performed for 96 couples using the Amplification Refractory Mutation System and Gap-Polymerase Chain Reaction. We identified 17 beta-globin defects-initiation codon for translation (T-G), -29 (A-G), -28 (A-G), CAP +1 (A-C), CD 8/9 (+G), CD 15 (G-A), CD 17 (A-T), CD 19 (A-G), Hb E (G-A), IVS1-1 (G-T), IVS1-5 (G-C), CD 41/42 (-CTTT), CD 71-72 (+A), IVS2-654 (CT), poly A(A-G), 100-kb Ggamma(Agammadeltabeta) degrees and 45-kb Filipino deletions. The 192 beta-alleles studied comprised Chinese (151 patients), Malay (21), Orang Asli from East Malaysia (15), Filipino (1), Indian (1), Indonesian Chinese (2), and Thai (1). In the Chinese, 2 beta-globin defects at CD 41/42 and IVS2-654 were responsible for 74% of beta-thalassemia. beta-mutations at CD 19, IVS1-1 (G-T), IVS1-5, poly A, and hemoglobin E caused 76% of the hemoglobin disorders in the Malays. The Filipino 45-kb deletion caused 73.3% of bthalassemia in the Orang Asli. Using genomic sequencing, the rare Chinese beta-mutation at CD 43 (G-T) was confirmed in 2 Chinese, and the Mediterranean mutation IVS1-1 (G-A) was observed in a Malay beta-thalassemia carrier. The beta-globin mutations confirmed in this prenatal diagnosis study were heterogenous and 65 (68%) couples showed a different globin defect from each other. The use of specific molecular protocols has allowed rapid and successful prenatal diagnosis of beta-thalassemia in Malaysia.
Fulltext High prevalence of alpha- and beta-thalassemia in the Kadazandusuns in East Malaysia: challenges in providing effective health care for an indigenous group

Tan JA, Lee PC, Wee YC, Tan KL, Mahali NF, George E, et al.

J Biomed Biotechnol, 2010;2010.
PMID: 20871816 DOI: 10.1155/2010/706872

Thalassemia can lead to severe transfusion-dependent anemia, and it is the most common genetic disorder in Malaysia. This paper aims to determine the prevalence of thalassemia in the Kadazandusuns, the largest indigenous group in Sabah, East Malaysia. α- and β-thalassemia were confirmed in 33.6% and 12.8%, of the individuals studied respectively. The high prevalence of α- and β-thalassemia in the Kadazandusuns indicates that thalassemia screening, genetic counseling, and prenatal diagnosis should be included as part of their healthcare system. This preliminary paper serves as a baseline for further investigations into the health and genetic defects of the major indigenous population in Sabah, East Malaysia.
Fulltext Pre-transplantation serum ferritin as a prognostic marker in allogeneic haemopoietic stem cell transplant patients in a tertiary care hospital in Malaysia

Thambiah SC, George E, Samsudin IN, Hong LH, Chuo LL, Ramli N, et al.

Natl Med J India, 2016 May-Jun;29(3):136-140.
PMID: 27808061

BACKGROUND: The principal cause of iron overload in patients with haematological malignancies is recurrent red cell transfusions for anaemia. The serum ferritin level reflects the iron burden in the body, in the absence of inflammation or liver disease. In Malaysia, data are lacking on the association between pre-transplant serum ferritin levels and outcome after allogeneic haemopoietic stem cell transplant.

METHODS: We did a cross-sectional study using retrospective data of 106 post-allogeneic haemopoietic stem cell transplant patients (HLA-matched sibling) with haematological malignancies at Hospital Ampang to determine the relationship between pre-transplant serum ferritin levels and post-transplant outcome, post-transplant complications and survival time. Patients were divided into two groups according to the iron status: serum ferritin level >1000 μg/L (iron overload) and <1000 μg/L.

RESULTS: The median age for patients was 30.5 (18-58) years. The median pre-transplantation serum ferritin level and the prevalence of pre-transplantation iron overload were 2423 (408.2-7664) μg/L and 87.5%, respectively. No significant association was found between iron status and demographic factors, type of haematological malignancy and post-transplant complications. Although insignificant, patients with iron overload had a shorter survival time (36 months) compared to those with no iron overload (40 months). There was also no significant association between the iron status and post-transplant outcome. Significant post-transplant complications associated with post-transplant outcome were the need for total parenteral nutrition (TPN) (p=0.014) and chronic graft-versus-host disease (GVHD) (p=0.008). Similarly, significant associations were found between age group (p=0.003), TPN (p=0.035) and chronic GVHD (p=0.012) with survival time using Kaplan-Meir analysis. However, after Cox regression, only age group was found to be significantly associated with survival time (p=0.014).

CONCLUSION: Serum ferritin is an acute phase reactant and its levels increase in the presence of tissue necrosis and inflammation. Both these events occur in haematological malignancies. Although serum ferritin level is a non-invasive, relatively cost-effective, widely available and practical indicator of iron status, it is not specific to iron overload. Therefore, a true association between the serum ferritin level and iron burden is problematic in patients with haematological malignancies.
Homozygosity for a new type of G gamma (A gamma delta beta)zero-thalassemia in a Malaysian male

George E, Faridah K, Trent RJ, Padanilam BJ, Huang HJ, Huisman TH

Hemoglobin, 1986;10(4):353-63.
PMID: 2427478

Hematological and clinical data are presented for a young Malay patient with a homozygous (delta beta)zero-thalassemic condition. His red blood cells contained 100% fetal hemoglobin with alpha and G gamma chains only. Detailed gene mapping defined a large deletion with a 5' end between the Aha III and Apa I sites, some 200-400 bp 5' to the A gamma globin gene and a 3' end beyond sequences 17-18 kb 3' to the beta globin gene. This G gamma (A gamma delta beta)zero-type of thalassemia is different from all the other six types described before. Comparison of the hematological data of this patient with those of homozygotes for either the Sicilian or Spanish types of G gamma A gamma (delta beta)zero-thalassemia showed no differences; all homozygotes have a moderate anemia which is accentuated by the relatively high oxygen affinity of the Hb F containing erythrocytes.
Fulltext Molecular characterisation of Haemoglobin Constant Spring and Haemoglobin Quong Sze with a Combine-Amplification Refractory Mutation System

Wee YC, Tan KL, Chua KH, George E, Tan JA

Malays J Med Sci, 2009 Jul;16(3):21-8.
PMID: 22589661 MyJurnal

BACKGROUND: The interaction of the non-deletional α(+)-thalassaemia mutations Haemoglobin Constant Spring and Haemoglobin Quong Sze with the Southeast Asian double α-globin gene deletion results in non-deletional Haemoglobin H disease. Accurate detection of non-deletional Haemoglobin H disease, which is associated with severe phenotypes, is necessary as these mutations have been confirmed in the Malaysian population.
METHODS: DNA from two families with Haemoglobin H disease was extracted from EDTA-anticoagulated whole blood and subjected to molecular analysis for α-thalassaemia. A duplex polymerase chain reaction was used to detect the Southeast Asian α-globin gene deletion. Polymerase chain reaction-restriction fragment length polymorphism analysis was then carried out to determine the presence of Haemoglobin Constant Spring and Haemoglobin Quong Sze. A combine-amplification refractory mutation system protocol was optimised and implemented for the rapid and specific molecular characterisation of Haemoglobin Constant Spring and Haemoglobin Quong Sze in a single polymerase chain reaction.
RESULTS AND CONCLUSIONS: The combine-amplification refractory mutation system for Haemoglobin Constant Spring and Haemoglobin Quong Sze, together with the duplex polymerase chain reaction, provides accurate pre- and postnatal diagnosis of non-deletional Haemoglobin H disease and allows detailed genotype analyses using minimal quantities of DNA.
KEYWORDS: Combine-ARMS; Hb Constant Spring; Hb Quong Sze; medical sciences
Fulltext Screening for intermediate and severe forms of thalassaemia in discarded red blood cells: optimization and feasibility

George E, Lai MI, Teh LK, Ramasamy R, Goh EH, Asokan K, et al.

Med J Malaysia, 2011 Dec;66(5):429-34.
PMID: 22390095 MyJurnal

Detection and quantification of Hb subtypes of human blood is integral to presumptive identification of thalassaemias. It has been used in neonatal screening of thalassaemia and Hb variants. The use of discarded red blood cells following processing of the cord blood for stem cells provides readily available diagnostic material for thalassaemia screening. In this study, we determined the range of Hb subtypes in 195 consecutive cord blood samples collected for cord blood banking. The 'cord blood samples' analysed were those of the remaining red blood cells after the cord blood was processed for stem cell storage. Quantification of Hb subtypes by high performance liquid chromatography (HPLC) was done on BioRad Variant II Hb testing system. Only 73 (36.5%) of the samples could be analyzed neat without dilution. With a 1:300 dilution with wash solution the acceptable area as recommended by the manufacturer for reading of a C-gram within the 1 to 3 million ranges were achieved in all. Eighteen (9%) 12 showed classical Hb Barts (y4) prerun peaks were confirmed by Sebia Hydrasys automated Hb gel electrophoresis and quantified by Sebia Capillarys 2 capillary electrophoresis. Only 1 (0.5%) was presumptively identified with HbH disease. Due to the limited number of samples no beta-thalassaemia major, Hb E beta-thalassaemia and Hb Barts hydrops fetalis were found. The HPLC assay was possible at a cost US$ 5 per sample and a turnover time of 10 samples per hour without technical difficulties. This study reports an effective and valuable protocol for thalassaemia screening in red blood cells which would otherwise be discarded during cord blood processing. Cord blood with severe and intermediate forms of thalassaemia can be preselected and not stored.
Alpha-thalassaemia in association with beta-thalassaemia patients in Malaysia: a study on the co-inheritance of both disorders

Wee YC, Tan KL, Kuldip K, Tai KS, George E, Tan PC, et al.

Community Genet, 2008;11(3):129-34.
PMID: 18376108 DOI: 10.1159/000113874

BACKGROUND/AIMS: Individuals with double heterozygosity for alpha- and beta-thalassaemia and heterozygous beta-thalassaemia show a similar haematological picture. Co-inheritance of alpha- and beta-thalassaemia in both partners may result in pregnancies with either Hb Bart's hydrops foetalis or beta-thalassaemia major, or pregnancies with both disorders.
METHODS: The co-inheritance of alpha-thalassaemia in 322 beta-thalassaemia carriers in Malaysia was studied.
RESULTS: The frequency of alpha-thalassaemia in the beta-thalassaemia carriers was 12.7% (41/322), with a carrier frequency of 7.8% for the SEA deletion, 3.7% for the -alpha(3.7) deletion, 0.9% for Hb Constant Spring and 0.3% for the -alpha(4.2) deletion.
CONCLUSION: Double heterozygosity for alpha- and beta-thalassaemia was confirmed in 5 out of the 41 couples and the risk of the fatal condition Hb Bart's hydrops foetalis was confirmed in two of these couples. Detection of the Southeast Asian (SEA) deletion in the Malaysian Malays in this study confirms that Hb Bart's hydrops foetalis can occur in this ethnic group. Results of this study have provided new information on the frequency and different types of alpha-thalassaemia (--(SEA), -alpha(3.7) and -alpha(4.2) deletions, Hb Constant Spring) in Malaysian beta-thalassaemia carriers.
Fulltext Analysis of α1 and α2 globin genes among patients with hemoglobin Adana in Malaysia

Lee TY, Lai MI, Ismail P, Ramachandran V, Tan JA, Teh LK, et al.

Genet. Mol. Res., 2016 Apr 07;15(2).
PMID: 27173219 DOI: 10.4238/gmr.15027400

Hemoglobin (Hb) Adana [HBA2: c179G>A (or HBA1); p.Gly60Asp] is a non-deletional α-thalassemia variant found in Malaysia. An improvement in the molecular techniques in recent years has made identification of Hb Adana much easier. For this study, a total of 26 Hb Adana α-thalassemia intermedia and 10 Hb Adana trait blood samples were collected from patients. Common deletional and non-deletional α-thalassemia genotypes were determined using multiplex gap polymerase chain reaction (PCR) and multiplex ARMS PCR techniques. Identification of the Hb Adana location on the α-globin gene was carried out using genomic sequencing and the location of the mutation was confirmed via restriction fragment length polymorphism-PCR. Among the 36 samples, 24 (66.7%) had the -α(3.7)/α(Cd59)α mutation, while the -α(3.7)/α(Cd59)α mutation accounted for 2 samples (5.6%) and the remaining 10 (27.8%) samples were α/α(Cd59)α. All 36 samples were found to have the Hb Adana mutation on the α2-globin gene. The position of the α-globin gene mutation found in our cases was similar to that reported in Indonesia (16%) but not to that in Turkey (0.6%). Our results showed that the Hb Adana mutation was preferentially present in the α2-globin genes in Malays compared to the other ethnicities in Malaysia. Thus, the Malays might have similar ancestry based on the similarities in the Hb Adana position.
Fulltext First observation of haemoglobin Malay alpha 2B2 26 (B1) Asn----Ser--a case report

George E, Huisman TH, Yang KG, Kutlari F, Wilson JB, Kutlar A, et al.

Med J Malaysia, 1989 Sep;44(3):259-62.
PMID: 2626142

A new haemoglobin, Haemoglobin Malay is described in a 22 year old Malay. Structural analysis showed a AAC----AGC mutation in codon 17, with the production of an abnormal beta chain (beta Malay) that has an Asn----Ser substitution at position beta 19. This haemoglobin variant could not be detected by conventional procedures.
Fulltext Anaemia in type 2 diabetes mellitus (T2DM) patients in Hospital Putrajaya

Thambiah CS, Samsudin IN, George E, Ranjit LK, Saat NS, Hussein Z, et al.

Malaysian Journal of Medicine and Health Sciences, 2015;11(1):49-62.
MyJurnal

Patients with diabetes have an earlier onset and increased severity of anaemia compared to those with similar degree of renal impairment from other causes. Anaemia is associated with an increased risk of vascular complications. In this study, we determined the prevalence of anaemia in T2DM patients and its association with sociodemographic, clinical and laboratory parameters in an endocrine tertiary hospital in Malaysia. This was a cross-sectional study using retrospective electronic data from January 2011 to December 2013 of 165 T2DM patients in Hospital Putrajaya. Data was analysed using IBM SPSS Statistics version 21.0 for Windows. The prevalence of anaemia was 39.4% and majority had normocytic normochromic (80%), mild (58.5%) anaemia. Majority were Malays (73.9%), aged below 60 with comparable gender percentage and long-standing, poorly-controlled DM [median fasting blood sugar (FBS) 8mmol/L; glycated haemoglobin (HbA1c) 7.9%]. Using the KDIGO chronic kidney disease (CKD) staging system, 86% of these patients were in stages 3-5. Anaemic patients had a significantly higher serum urea, creatinine and a lower FBS, estimated glomerular filtration rate (eGFR) compared to non-anaemic patients. Anaemic patients with diabetic nephropathy had a significantly lower haemoglobin (Hb) compared to those without this complication (p=0.022). The sensitivity and specificity at a cut-off eGFR value of 38.3 ml/min/1.73 m2 (maximum Youden index = 0.462) was 66.7% and 79.5%, respectively to discriminate mild from moderate anaemia. This study shows that anaemia is already present in T2DM patients in Hospital Putrajaya at initial presentation to the specialist outpatient clinic and is significantly associated with CKD. Hence, it emphasises the obligatory need for routine and follow-up full blood count monitoring in T2DM patients in primary care as well as tertiary settings in Malaysia to enable early detection and aggressive correction of anaemia in preventing further complications.

Study site: endocrine clinic, Hospital Putrajaya
Fulltext Relationship between dyslipidaemia and glycaemic status in patients with Type 2 diabetes mellitus

Thambiah SC, Samsudin IN, George E, Zahari Sham SY, Lee HM, Muhamad MA, et al.

Malays J Pathol, 2016 Aug;38(2):123-30.
PMID: 27568669 MyJurnal

The risk of coronary heart disease (CHD) is dramatically increased in diabetic patients due to their atherogenic lipid profile. The severity of CHD in diabetic patients has been found to be directly associated with glycated haemoglobin (HbA1c). According to the Malaysian Clinical Practice Guidelines on diabetes mellitus (DM), HbA1c level less than 6.5% reduces the risk of microvascular and macrovascular complications. Hence, this study aimed to determine the relationship between dyslipidaemia and glycaemic status in patients with type 2 DM (T2DM) patients in Hospital Putrajaya, a tertiary endocrine centre in Malaysia. This was a cross sectional, retrospective study of 214 T2DM patients with dyslipidaemia who had visited the endocrine clinic between January 2009 and December 2012. Significant correlations were found between fasting blood glucose (FBG) and HbA1c with total cholesterol (TC), triglyceride (TG), low density lipoprotein cholesterol (LDL), non-high density lipoprotein cholesterol (non-HDL), LDL/HDL ratio and TC/HDL ratio; greater correlation being with HbA1c than FBG. In patients with HbA1c ≥ 6.5%, TC, TG, non-HDL and TC/HDL ratio were significantly higher than in patients with HbA1c < 6.5%. Non-HDL, LDL/HDL ratio, TC/HDL ratio and HbA1c were significantly lower in patients on statin treatment than nontreated patients (p<0.05). This significant association between glycaemic status and dyslipidaemia emphasises the additional possible use of HbA1c as a biomarker for dyslipidaemia as well as a potential indirect predictor of cardiovascular disease (CVD) risk in T2DM patients.
Types of thalassemia among patients attending a large university clinic in Kuala Lumpur, Malaysia

George E, Li HJ, Fei YJ, Reese AL, Baysal E, Cepreganova B, et al.

Hemoglobin, 1992;16(1-2):51-66.
PMID: 1634362

We have identified the beta-thalassemia mutations in 59 patients with thalassemia major and 47 patients with Hb E-beta-thalassemia, and the deletional and nondeletional alpha-thalassemia determinants in 23 out of 24 patients with Hb H disease. All persons were attending the Haematology Clinic at the National University of Malaysia in Kuala Lumpur (Malaysia). Most patients (76) were of Malay descent, while 52 patients were Chinese, and two came from elsewhere. The most frequently occurring beta-thalassemia alleles among the Malay patients were IVS-I-5 (G----C) and G----A at codon 26 (Hb E), while a few others were present at lower frequencies. The Chinese patients carried the mutation characteristic for Chinese [mainly codons 41/42 (-TTCT) and IVS-II-654 (C----T)]; Malay mutations were not observed among Chinese and Chinese mutations were virtually absent in the Malay patients. The large group of patients with Hb E-beta-thalassemia and different beta-thalassemia alleles offered the opportunity of comparing hematological data; information obtained for patients with Hb E-beta-thalassemia living in other countries was included in this comparison. Twenty-three patients with Hb H disease carried the Southeast Asian (SEA) alpha-thalassemia-1 deletion; 13 had the alpha CS alpha (Constant Spring) nondeletional alpha-thalassemia-2 determinant, while the deletional alpha-thalassemia-2 (-3.7 or -4.2 kb) was present in 10 subjects. The --/alpha CS alpha condition appeared to be the most severe with higher Hb H values. Both deletional and nondeletional types of alpha-thalassemia-2 were seen among Malay and Chinese patients.
Transfusion-dependent thalassemia in Northern Sarawak: a molecular study to identify different genotypes in the multi-ethnic groups and the importance of genomic sequencing in unstudied populations

Tan JA, Chin SS, Ong GB, Mohamed Unni MN, Soosay AE, Gudum HR, et al.

Public Health Genomics, 2015;18(1):60-4.
PMID: 25412720 DOI: 10.1159/000368342

BACKGROUND: Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak.
METHODS: Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing.
RESULTS: Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients.
CONCLUSION: The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations.

Filters

Please provide feedback to Administrator (afdal@afpm.org.my)

External Links