Displaying publications 121 - 140 of 159 in total

Abstract:
Sort:
  1. Salina H., Lim P.S., Gendeh B.S.
    MyJurnal
    Hereditary Hemorrhagic Telangiectasia, also known as Osler-Weber-Rendu Syndrome is an autosomal
    dominant disorder causing systemic abnormalities of the vascular structure. There are multiple arteriovenous malformations present in the skin and mucosal surface of the nail beds, nose, gastrointestinal tract, lungs and brain. Epistaxis is the common presentation symptom, which may require multiple hospital admissions and blood transfusions. It is extremely rare disease in our population. We report 4 cases of HHT who presented to us with moderate to severe epistaxis and how we managed these patients.
    Matched MeSH terms: Blood Transfusion
  2. Salleh MI, Chia YT
    Med J Malaysia, 1993 Sep;48(3):345-6.
    PMID: 8183150
    We are reporting a case of autologous blood transfusion in a patient who underwent a repair of her aortic aneurysm. Even though the operation was major and carried a high mortality, no homologous blood was used at all.
    Matched MeSH terms: Blood Transfusion, Autologous*
  3. Shafie AA, Chhabra IK, Wong JHY, Mohammed NS
    Health Qual Life Outcomes, 2021 Jan 07;19(1):10.
    PMID: 33413416 DOI: 10.1186/s12955-020-01645-0
    PURPOSE: There is a gap of information describing the health state utility values (HSUVs) of transfusion-dependent thalassemia (TDT) patients in Malaysia. These values are useful in the assessment of health-related quality of life (HRQoL), economic evaluations and provide guidance to disease management decisions. The objective of this study was to estimate and derive HSUVs associated with the treatment and complications of TDT patients in Malaysia using the EQ-5D-3L instrument.

    METHODS: A cross-sectional survey using the EQ-5D-3L instrument was conducted between May to September 2018 across various public hospitals in Malaysia. Using a multi-stage sampling, patients diagnosed with TDT and receiving iron chelating therapy were sampled. The findings on the EQ-5D-3L survey were converted into utility values using local tariff values. A two-part model was used to examine and derive the HSUVs associated with the treatment and complications of iron overload in TDT.

    RESULTS: A total of 585 patients were surveyed. The unadjusted mean (SD) EQ-5D-3L utility value for TDT patients were 0.893 (0.167) while mean (SD) EQ VAS score was 81.22 (16.92). Patients who had more than two iron overload complications had a significant decline in HRQoL. Patients who were on oral monotherapy had a higher utility value of 0.9180 compared to other regimen combinations.

    CONCLUSION: Lower EQ-5D-3L utility values were associated with patients who developed iron overload complications and were on multiple iron chelating agents. Emphasizing compliance to iron chelating therapy to prevent the development of complications is crucial in the effort to preserve the HRQoL of TDT patients.

    Matched MeSH terms: Blood Transfusion/psychology*
  4. Shafie AA, Wong JHY, Ibrahim HM, Mohammed NS, Chhabra IK
    Orphanet J Rare Dis, 2021 04 07;16(1):157.
    PMID: 33827621 DOI: 10.1186/s13023-021-01791-8
    BACKGROUND: Transfusion-dependent thalassaemia (TDT) is a hereditary blood disorder in which blood transfusion is the mainstay treatment to prolong survival and improve quality of life. Patients with this disease require blood transfusion at more than 100 ml/kg annually and iron-chelating therapy (ICT) to prevent iron overload (IOL) complications. There are substantial numbers of TDT patients in Malaysia, but limited data are available regarding the economic burden associated with this disease. The purpose of this study was to determine the lifetime cost of TDT from a societal perspective and identify potential factors increasing patient and family expenditures among thalassaemia populations.

    METHODS: The total lifetime cost per TDT patient (TC1) is the sum of lifetime healthcare cost (TC2) and lifetime patient and family healthcare expenditure (TC3). TC2 was simulated using the Markov model, taking into account all costs subsidized by the government, and TC3 was estimated through a cross-sectional health survey approach. A survey was performed using a two-stage sampling method in 13 thalassaemia centres covering all regions in Malaysia.

    RESULTS: A TDT patient is expected to incur TC2 of USD 561,208. ICT was the main driver of cost and accounted for 56.9% of the total cost followed by blood transfusion cost at 13.1%. TC3 was estimated to be USD 45,458. Therefore, the estimated TC1 of a TDT patient was USD 606,665. Sensitivity analyses showed that if all patients were prescribed oral ICT deferasirox for their lifetime, the total healthcare cost would increase by approximately 65%. Frequency of visits to health facilities for blood transfusion/routine monitoring and patients who were prescribed desferrioxamine were observed to be factors affecting patient and family monthly expenses.

    CONCLUSION: The lifetime cost per TDT patient was USD 606,665, and this result may be useful for national health allocation planning. An estimation of the economic burden will provide additional information to decision makers on implementing prevention interventions to reduce the number of new births and medical service reimbursement.

    Matched MeSH terms: Blood Transfusion
  5. Shafiee, M.N., NorAzlin, M.I., Lim, P.S., Arifuddin D, Trika I, Hatta, D.
    MyJurnal
    Fulminant haemorrhage in cervical cancer leads to severe anaemia and haemodynamic instability. Palliative management includes vaginal packing as temporary measure, radiotherapy and other invasive surgical procedures. High dose emergency chemotherapy is not commonly implemented particularly when complicated with anaemia and renal impairment. We discuss three case series on the usefulness of high dose chemotherapy to combat bleeding from cervical cancer as an emergency treatment. The first case was clinically staged as operable 2A disease with severe anaemia due to bleeding from the tumour mass. The haemoglobin was corrected by blood transfusion while the bleeding was being arrested by high dose chemotherapy. The second case was inoperable with invasion to the bladder mucosa. She had frank haematuria and bleeding from the tumour with severe anaemia. A course of chemotherapy and blood transfusion controlled the bleeding and anaemia was corrected. The third case presented late with obstructive uropathy and anaemia. She required dialysis, blood transfusion and high dose emergency chemotherapy to stop the bleeding before undergoing urinary diversion after an unsuccessful ureteric stenting. High dose chemotherapy consisting cisplatin, vincristine, bleomycin and mitomycin-C has a clinical value in arresting fulminant haemorrhage in cervical cancer.
    Matched MeSH terms: Blood Transfusion
  6. Sim PH, Razack AH, Jalleh RP
    Med J Malaysia, 1995 Dec;50(4):346-52.
    PMID: 8668055
    A retrospective study was carried out on 42 patients (38 males, 4 females, mean age 25.9) with liver injury at the University Hospital, Kuala Lumpur from 1994 through to 1991. Prognostic factors that might help to identify those patient survival was related to pulse rate on arrival ( < or = 120 beats per minute, p = 0.027), systolic blood pressure at induction of anaesthesia ( > or = to 80 mmHg, p = 0.003) and intraoperative blood transfusion of < or = to 4 units (p = 0.05). This data were supported by the 95% confidence interval suggesting that these factors may be strong prognostic indicators individually. Increased mortality was also associated with increased total blood transfused (p = 0.002) and grade of liver injury (p = 0.02). Although the factors we have identified reflect both the severity of injury and resuscitative and surgical efforts, further studies using a prospective design are required to confirm these findings.
    Matched MeSH terms: Blood Transfusion
  7. Sreenevasan GA
    Med J Malaysia, 1985 Mar;40(1):1-2.
    PMID: 3831726
    Matched MeSH terms: Blood Transfusion*
  8. Strahan JH
    Trans R Soc Trop Med Hyg, 1948;41:669-671.
    1.This paper records the treatment by a continuous intravenous quinine drip technique of fifteen cases of heavy P. falciparum infection in malnourished prisoners of war in a Singapore camp. These cases were selected from a series of approximately 1,000.2.The efficiency of the method, its simplicity, and the ease with which it can be combined with blood transfusion or the slow administration of thiamin are stressed.3.Recovery by this method of treatment is recorded of three cases with a peripheral intensity of infection higher than has hitherto been reported in Malaya with survival.4.The author is of the opinion that this is a safe and effective method for the treatment of pernicious falciparum infections.
    Matched MeSH terms: Blood Transfusion
  9. Suria, A.A., Nurdiayana, M.N., Huik, May L., Alex, Y.C.S, Noornabillah, R., Hud, M.A., et al.
    Medicine & Health, 2012;7(1):41-46.
    MyJurnal
    Red cell alloimmunisation is defined as the development of antibodies in response to foreign red cell antigens through transfusion or pregnancy. In pregnant women even without the history of previous blood transfusion, this is possible through previous or current pregnancy with the presence of paternal red cell antigen inherited by the fetus. This study was aimed to determine the prevalence of red cell alloimmunisation among pregnant women without previous history of blood transfusion and the association with number of pregnancy and history of obstetric complications. This was a cross-sectional study in which 150 pregnant women were randomly selected from the antenatal clinic. Ten mls of peripheral blood was obtained for antibody screening using indirect antiglobulin test besides the routine antenatal screening. In this study, the majority (37.3%) of the women were primigravidae. Red cell alloantibodies were detected in two out of 150 (1.3%) patients which were subsequently identified as anti-C and anti-D. However none of the primigravida was alloimmunised. One woman of gravida 2 (2.9%) and gravida 3 (3.6%) each were positive for alloimmunisation. One of them also had a bad obstetric history. This study showed that the prevalence of red cell alloimmunisation among pregnant women was low in this centre. Nevertheless, red cell alloantibody screening test should be made available to reduce possible complications of alloimmunisation in mothers and fetuses.
    Study site: Antenatal clinic, Pusat Perubatan Universiti Kebangsaan Malaysia (PPUKM), Kuala Lumpur, Malaysia
    Matched MeSH terms: Blood Transfusion
  10. Taher AT, Origa R, Perrotta S, Kouraklis A, Ruffo GB, Kattamis A, et al.
    Health Qual Life Outcomes, 2018 Nov 19;16(1):216.
    PMID: 30453981 DOI: 10.1186/s12955-018-1041-5
    BACKGROUND: Adherence to long-term chelation therapy in transfusion-dependent patients is critical to prevent iron overload-related complications. Once-daily deferasirox dispersible tablets (DT) have proven long-term efficacy and safety in patients ≥2 years old with chronic transfusional iron overload. However, barriers to optimal adherence remain, including palatability, preparation time, and requirements for fasting state. A new film-coated tablet (FCT) formulation was developed, swallowed once daily (whole/crushed) with/without a light meal.

    METHODS: The open-label, Phase II ECLIPSE study evaluated patient-reported outcomes (PROs) in transfusion-dependent thalassemia or lower-risk myelodysplastic syndromes patients randomized 1:1 to receive deferasirox DT or FCT over 24 weeks as a secondary outcome of the study. Three PRO questionnaires were developed to evaluate both deferasirox formulations: 1) Modified Satisfaction with Iron Chelation Therapy Questionnaire; 2) Palatability Questionnaire; 3) Gastrointestinal (GI) Symptom Diary.

    RESULTS: One hundred seventy three patients were enrolled; 87 received the FCT and 86 the DT formulation. FCT recipients consistently reported better adherence (easier to take medication, less bothered by time to prepare medication and waiting time before eating), greater satisfaction/preference (general satisfaction and with administration of medicine), and fewer concerns (less worry about not swallowing enough medication, fewer limitations in daily activities, less concern about side effects). FCT recipients reported no taste or aftertaste and could swallow all their medicine with an acceptable amount of liquid. GI summary scores were low for both formulations.

    CONCLUSIONS: These findings suggest a preference in favor of the deferasirox FCT formulation regardless of underlying disease or age group. Better patient satisfaction and adherence to chelation therapy may reduce iron overload-related complications.

    TRIAL REGISTRATION: ClinicalTrials.gov identifier: NCT02125877; registered April 26, 2014.

    Matched MeSH terms: Blood Transfusion
  11. Tai, C.C., Tan, S.H., Misnan, N.A., Nam, H.Y., Choon, S.K.
    Malays Orthop J, 2008;2(1):38-43.
    MyJurnal
    The safety of simultaneous bilateral total knee arthroplasty (TKA) remains controversial. The objective of the current study was to investigate perioperative morbidity and mortality rates within 30 days of simultaneous bilateral TKA. A detailed analysis of medical, surgical and anaesthesia records of 183 consecutive patients who underwent total knee arthroplasty between 2002 and 2006 was performed. The mean age of the patients was 67.6 years old. More than 80% had one or more co-morbidities, but none of them had ASA score greater than class 2. The mean hospital stay was 10 days, and the mean surgical time 156 minutes. Less than half of the patients (42.6%) required blood transfusion. The rate of perimorbidity was 15.3 % and there was no mortality in this series. We believe that simultaneous bilateral total knee arthroplasty is a safe and cost effective option for our patients, provided that patients are selected and informed appropriately.
    Matched MeSH terms: Blood Transfusion
  12. Tan JAMA, Yap SF, Tan KL, Wong YC, Wee YC, Kok JL
    Acta Haematol., 2003;109(4):169-75.
    PMID: 12853688 DOI: 10.1159/000070965
    Molecular characterization of the compound heterozygous condition - (G)gamma((A)gammadeltabeta)(o)/beta-thalassemia - in four families showing mild beta-thalassemia intermedia was carried out using DNA amplification techniques. Using the Amplification Refractory Mutation System (ARMS) to confirm the beta-mutations and DNA amplification to detect the 100-kb Chinese-specific (G)gamma((A)gammadeltabeta)(o)-deletion, ()two families were confirmed to possess (G)gamma((A)gammadeltabeta)(o)/beta-thalassemia with the IVSII No. 654 beta(+)-allele. In the third family, the (G)gamma((A)gammadeltabeta)(o)-deletion was confirmed in the father and the mother was a beta-thalassemia carrier with the cd 41-42 beta(o)-allele. Their affected child with (G)gamma((A)gammadeltabeta)(o)/beta-thalassemia was found to be transfusion dependent. The same (G)gamma((A)gammadeltabeta)(o)-deletion and beta-thalassemia (cd 41-42) was also confirmed in a fourth family. In addition, the mother was also diagnosed with Hb H disease (genotype -alpha(3.7)/-(SEA)). Both the children were found to possess (G)gamma((A)gammadeltabeta)(o)/beta-thalassemia but they were not transfusion dependent and this could be due to co-inheritance of alpha-thalassemia-2 (genotype-alpha(3.7)/alphaalpha) in the children together with their compound heterozygous condition.
    Matched MeSH terms: Blood Transfusion
  13. Tan JA, Chin SS, Ong GB, Mohamed Unni MN, Soosay AE, Gudum HR, et al.
    Public Health Genomics, 2015;18(1):60-4.
    PMID: 25412720 DOI: 10.1159/000368342
    BACKGROUND: Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak.
    METHODS: Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing.
    RESULTS: Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients.
    CONCLUSION: The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations.
    Matched MeSH terms: Blood Transfusion/methods*
  14. Tan JA, Tan KL, Omar KZ, Chan LL, Wee YC, George E
    Eur J Pediatr, 2009 Sep;168(9):1049-54.
    PMID: 19034506 DOI: 10.1007/s00431-008-0877-9
    INTRODUCTION: Interactions of different hemoglobin variants with thalassemia alleles can result in various clinical phenotypes. HbE-beta-thalassemia generally manifests with severe anemia where individuals exhibit beta-thalassemia major with regular blood transfusions or beta-thalassemia intermedia with periodic blood transfusions. This study presents a unique Malay family with three beta-globin gene defects-HbE, Hb South Florida, and IVS1-1 (G-->A).

    MATERIALS AND METHODS: HbE activates a cryptic splice site that produces non-functional mRNAs. Hb South Florida is a rare beta-hemoglobin variant, and its interactions with other beta-thalassemia alleles have not been reported. IVS1-1 is a Mediterranean mutation that affects mRNA processing giving rise to beta(o)-thalassemia.

    RESULTS AND DISCUSSION: Fifteen mutations along the beta-globin gene complex were analyzed using the amplification refractory mutation system. Hb South Florida was identified by direct sequencing using genomic DNA.

    CONCLUSION: The affected child with HbE/IVS1-1 produced a beta-thalassemia major phenotype. Compound heterozygosity for Hb South Florida/IVS1-1 produced a beta-thalassemia carrier phenotype in the mother.

    Matched MeSH terms: Blood Transfusion
  15. Tan KA, Lum SH, Yahya A, Krishnan S, Jalaludin MY, Lee WS
    Singapore Med J, 2019 Jun;60(6):303-308.
    PMID: 30556093 DOI: 10.11622/smedj.2018155
    INTRODUCTION: Endocrine dysfunction due to iron overload secondary to frequent blood transfusions is a common complication in children with transfusion-dependent thalassaemia (TDT). We ascertained the prevalence of endocrine dysfunction in children with TDT seen in a hospital setting in Malaysia.

    METHODS: We reviewed all patients with TDT who had ≥ 8 blood transfusions per year. Patients who had a history of stem cell transplantation, concurrent autoimmune diseases or were newly diagnosed to have TDT were excluded. Standard diagnostic criteria were used in the diagnosis of various endocrine dysfunctions.

    RESULTS: Of the 82 patients with TDT, 65% had at least one endocrine dysfunction. Short stature was the commonest (40.2%), followed by pubertal disorders (14.6%), hypoparathyroidism (12.3%), vitamin D deficiency (10.1%), hypocortisolism (7.3%), diabetes mellitus (5.2%) and overt hypothyroidism (4.9%). Subclinical hypothyroidism and pre-diabetes mellitus were seen in 13.4% and 8.6% of the patients, respectively. For children aged < 10 years, the prevalence of both thyroid dysfunction and hypoparathyroidism was 9.1%.

    CONCLUSION: Two-thirds of children with TDT experienced at least one endocrine dysfunction. Thyroid dysfunction and hypoparathyroidism may be missed if endocrine screening is only performed in children with TDT > 10 years of age. Close monitoring for endocrine dysfunction and hormonal therapy is essential to prevent long-term adverse outcomes.

    Matched MeSH terms: Blood Transfusion*
  16. Tan KK, Lee WS, Liaw LC, Oh A
    Singapore Med J, 1993 Apr;34(2):109-11.
    PMID: 8266145
    Two hundred and eleven blood transfusions were administered to 26 multi-transfused thalassemic children (aged 9 months-13 years) over a 6-month period. Eighteen children were receiving buffy coat-poor packed red cells (PRC) prepared by centrifuge while 8 children received filtered blood through a leucocyte-filter (Sepacell R-500A). Transfusion reactions occurred in 8.5% (n = 18) of transfusions and in 42.3% (n = 11) of patients. 11.9% (n = 16) and 2.6% (n = 2) of reactions occurred in 50% (n = 9) and 25% (n = 2) of patients receiving buffy coat-poor PRC and filtered blood respectively. Transfusion reactions in toto were significantly reduced in the group receiving filtered blood (p < 0.05). However, febrile reaction alone was not significantly reduced (p > 0.1). The median onset and duration of reaction were 2 hours (range 10 minutes-18 hours) and 4 hours (range 1/2-24 hours) respectively. 72.2% (n = 13) of the reactions occurred occurred during transfusion. 88.8% (n = 16) of the reactions caused only one symptom. 19.2% (n = 5) of all patients had recurrent reactions, all of them receiving buffy coat-poor PRC. The commonest clinical manifestation was fever (n = 7), followed by urticaria (n = 5) and petechial rash (n = 2). The outcome was good, with no patient experiencing symptoms exceeding 24 hours. Only 0.9% (n = 2) of the transfusions were discontinued.
    Matched MeSH terms: Blood Transfusion/adverse effects*; Blood Transfusion/methods
  17. Tan PP, Mohamed Fauzi, H., Chang CT, Ahmad NH, Bahar B, Mangantig E, et al.
    MyJurnal
    ABSTRACTS FOR INTERNATIONAL HEALTH AND MEDICAL SCIENCES CONFERENCE 2019 (IHMSC 2019)
    Held at Taylor’s University Lakeside Campus, Subang Jaya, Selangor, Malaysia, 8-9th March, 2019
    Introduction: Unsafe blood products cause transfusion-transmissible infections among blood receivers. The knowledge and perception of blood donors is important as it is associated with their donation behaviour and hence the safety of blood products. There was no previous study that assessed the knowledge and perception on blood safety issues among blood donors to date. The objective of this study was to assess the knowledge and perception of blood
    donors on blood safety issues.
    Methods: This was a pilot study conducted to pilot test the self-developed questionnaire by the researchers. The questionnaire was available in the Malay language. One-hundred-thirty donors at the National Blood Centre were recruited to complete the self-administered questionnaire. Health sciences professionals, medical students and non-Malaysians were excluded in this study.
    Results: A total of 130 donors comprising of 70 males (53.8%) and 60 females (46.2%) responded. The mean age of the respondents is 32.48±8.86 years. Most of the respondents were Malay (55.4%), single (49.2%), working in private sector (46.9%) and regular donor (68.5%). More than half of the respondents did not know that dengue, Zika and mad-cow disease can be contracted through blood transfusion. Ten percent of the respondents answered that bisexual people are eligible to donate blood. 40.7% of the donors agreed to check their HIV status through blood donation. Majority of the donors (60.7%) agreed that the donors’ blood is safe if the screening test is negative. Whereas, 33.9% of the donors disagreed that they shall be responsible if their blood causes infection.
    Conclusion: Several knowledge gaps and inappropriate perception among the respondents were identified and these might affect the safety of the blood products. Targeted measures should be taken to rectify donors’ knowledge and perception in order to minimise inappropriate blood donor behaviours and reduce unsafe blood products.
    Matched MeSH terms: Blood Transfusion
  18. Tang YL, Yousuf R, Wan Nawawi WM, Rahman IL, Zainal Abidin J, Rechard Nathan VR, et al.
    Malays J Pathol, 2019 Aug;41(2):161-167.
    PMID: 31427551
    INTRODUCTION: Overnight transfusion (OT) is the blood transfusion taking place from 9pm to 8am. During this period, patients are exposed to increased risk of errors. This cross-sectional study aims to determine the incidence and practice of OT in Universiti Kebangsaan Malaysia Medical Centre.

    MATERIALS & METHODS: Data from all OT in June and mid-July 2017 were collected from recipients' cards, transfusion request forms and patient's case files, regarding discipline involved, indications, time intervals from request of blood transfusion to the completion of OT on patients, monitoring of patients and adverse reactions.

    RESULTS: A total of 1285 transfusion cases were identified during the study period. 216 (16.8%) cases were OT while the 1069 (83.2%) cases were non-OT. Surgery discipline has the highest (30.1%) OT. The indications of OT were acute clinical need: 82.9%, less acute clinical need: 13.9% and no clinical need: 3.2%. A huge delay (average: 5 hours 40 minutes) in starting transfusion after grouping and crossmatching (GXM) completion was noted. Besides, 25.9% cases took <4 hours to complete OT; 83.4% cases did not have proper transfusion monitoring and three transfusion reactions were reported.

    DISCUSSION: Although most of the OT cases had appropriate clinical indications, the transfusion can be commenced earlier at day time rather than overnight. Cases without absolute indication should avoid OT. The poor monitoring of patient during OT had posed risks to patients' life if an adverse transfusion reaction happened. The major reason for OTs was a huge delay in starting transfusion after the GXM completion. The contravention of 4-hour infusion rule increased the patients' risk of developing bacterial sepsis. The practice of OT should be discouraged wherever possible except for clinically indicated cases.

    Matched MeSH terms: Blood Transfusion
  19. Teh LK, George E, Lai MI, Tan JA, Wong L, Ismail P
    J Hum Genet, 2014 Mar;59(3):119-23.
    PMID: 24369358 DOI: 10.1038/jhg.2013.131
    Beta-thalassemia is one of the most prevalent inherited diseases and a public health problem in Malaysia. Malaysia is geographically divided into West and East Malaysia. In Sabah, a state in East Malaysia, there are over 1000 estimated cases of β-thalassemia major patients. Accurate population frequency data of the molecular basis of β-thalassemia major are needed for planning its control in the high-risk population of Sabah. Characterization of β-globin gene defects was done in 252 transfusion dependent β-thalassemia patients incorporating few PCR techniques. The study demonstrates that β-thalassemia mutations inherited are ethnically dependent. It is important to note that 86.9% of transfusion-dependent β-thalassemia major patients in Sabah were of the indigenous population and homozygous for a single mutation. The Filipino β(0)-deletion was a unique mutation found in the indigenous population of Sabah. Mutations common in West Malaysia were found in 11 (4.3%) patients. Four rare mutations (Hb Monroe, CD 8/9, CD 123/124/125 and IVS I-2) were also found. This study is informative on the population genetics of β-thalassemia major in Sabah.
    Matched MeSH terms: Blood Transfusion*
Filters
Contact Us

Please provide feedback to Administrator (afdal@afpm.org.my)

External Links