METHODS: Liquid chromatography-high resolution mass spectrometry (LC-HRMS) using untargeted approach combined with chemometrics was applied for analysis non-halal meats in BMr.
RESULTS: The untargeted metabolomics approach successfully identified various metabolites in BMr DMr, PMr, and their mixtures. The discrimination and classification between authentic BMr and those adulterated with DMr and PMr were successfully determined using partial least square-discriminant analysis (PLS-DA) with high accuracy. All BMr samples containing non-halal meats could be differentiated from authentic BMr. A number of discriminating metabolites with potential as biomarkers to discriminate BMr in the mixtures with DMr and PMr could be identified from the analysis of variable importance for projection value. Partial least square (PLS) and orthogonal PLS (OPLS) regression using discriminating metabolites showed high accuracy (R2>0.990) and high precision (both RMSEC and RMSEE <5%) in predicting the concentration of DMr and PMr present in beef indicating that the discriminating metabolites were good predictors. The developed untargeted LC-HRMS metabolomics and chemometrics successfully identified non-halal meats adulteration (DMr and PMr) in beef with high sensitivity up to 0.1% (w/w).
CONCLUSION: A combination of LC-HRMS untargeted metabolomic and chemometrics promises to be an effective analytical technique for halal authenticity testing of meats. This method could be further standardized and proposed as a method for halal authentication of meats.
Materials and Methods: The novel SSP of CYTBWB2-wb was designed by our group using PRIMERQUEST and NCBI software. DNA was extracted using propanol-chloroform-isoamyl alcohol method. The designed SSP was further subjected for validation protocols using DNA isolated from fresh meat and from meatball, which include specificity test, determination of efficiency, limit of detection and repeatability, and application of developed method for analysis of commercially meatball samples.
Results: The results showed that CYTBWB2-wb was specific to wild boar species against other animal species with optimized annealing temperature of 59°C. The efficiency of q-PCR obtained was 91.9% which is acceptable according to the Codex Allimentarius Commission (2010). DNA, with as low as 5 pg/μl, could be detected using q-PCR with primer of CYTBWB2-wb. The developed method was also used for DNA analysis extracted from meatball samples commercially available.
Conclusion: q-PCR using CYTBWB2-wb primers targeting on mitochondrial cytochrome-b gene (forward: CGG TTC CCT CTT AGG CAT TT; Reverse: GGA TGA ACA GGC AGA TGA AGA) can be fruitfully used for the analysis of WBM in commercial meatball samples.
AIM: This study aims to develop a real-time polymerase chain reaction (RT-PCR) analysis method to analyze the presence of RM in beef meatballs.
METHODS: This research was carried out in the following stages: primer design, DNA isolation, analysis of DNA isolates, the optimization of primer annealing temperature, primer specificity test, sensitivity, and repeatability. The validated RT-PCR method was then used to analyze the marketed meatball samples.
RESULTS: The result showed that the designed primer targeting on ND2 gene set rat mt-DNA (forward: ACTCCATATCTCTCACCATATTTCC; reverse: GGGTTAGGGTACTTAGGATTGTTAG), had good specificity at an optimal annealing temperature of 56.3oC over the other eight species. The developed RT-PCR method produces a limit detection value of 195.31 pg, coefficient of determination (R 2) for linearity of 0.983, amplification efficiency (E) of 100%, and CV value for amplification response of 1.8%. The result showed that the developed RT-PCR method did not detect the presence of RM DNA in eight marketed beef meatball samples.
CONCLUSION: The developed method meets the acceptance criteria for RT-PCR and can be used as a halal authentication method to identify the presence of RM in beef meatballs.