MyMedR

Displaying publications 1 - 20 of 68 in total

Abstract:

Sort:

Fulltext α-Thalassemia with Haemoglobin Adana mutation: prenatal diagnosis

Zainal NZ, Alauddin H, Ahmad S, Hussin NH

Malays J Pathol, 2014 Dec;36(3):207-11.
PMID: 25500521

Thalassaemia carriers are common in the Asian region including Malaysia. Asymptomatic patients can be undiagnosed until they present for their antenatal visits. Devastating obstetric outcome may further complicate the pregnancy if both parents are thalassaemia carriers leading to hydrophic fetus due to haemoglobin Bart's disease. However in certain cases where unexplained hydrops fetalis occur in parents with heterozygous thalassaemia carrier,mutated α genes should be suspected. We report a twenty-nine year old woman in her third pregnancy with two previous pregnancies complicated by early neonatal death at 21 and 28 weeks of gestation due to hydrops fetalis. DNA analysis revealed the patient to have heterozygous (--SEA) α-gene deletion, while her husband has a compound heterozygosity for α(3.7) deletion and codon 59 (GGC → GAC) mutation of the α-gene. This mutation, also known as hemoglobin Adana, can explain hydrops fetalis resulting from two alpha gene deletions from the patient (mother) and a single alpha gene deletion with mutation from the father. The third pregnancy resulted in a grossly normal baby boy with 3 α-gene deletions (HbH disease). We postulate that, in view of heterogenisity of the α-thalassaemia in this patient with severely unstable haemoglobin Adana chains from her husband, there will be a 25% possibility of fetal hydrops in every pregnancy.

Matched MeSH terms: Hemoglobins, Abnormal/genetics*
Molecular characterization of beta-globin gene mutations in Malay patients with Hb E-beta-thalassaemia and thalassaemia major

Yang KG, Kutlar F, George E, Wilson JB, Kutlar A, Stoming TA, et al.

Br J Haematol, 1989 May;72(1):73-80.
PMID: 2736244

This study concerned the identification of the beta-thalassaemia mutations that were present in 27 Malay patients with Hb E-beta-thalassaemia and seven Malay patients with thalassaemia major who were from West Malaysia. Nearly 50% of all beta-thalassaemia chromosomes carried the G----C substitution at nucleotide 5 of IVS-I; the commonly occurring Chinese anomalies such as the frameshift at codons 41 and 42, the nonsense mutation A----T at codon 17, the A----G substitution at position -28 of the promoter region, and the C----T substitution at position 654 of the second intron, were rare or absent. Two new thalassaemia mutations were discovered. The first involves a frameshift at codon 35 (-C) that was found in two patients with Hb E-beta zero-thalassaemia and causes a beta zero-thalassaemia because a stop codon is present at codon 60. The second is an AAC----AGC mutation in codon 19 that was present on six chromosomes. This substitution results in the production of an abnormal beta chain (beta-Malay) that has an Asn----Ser substitution at position beta 19. Hb Malay is a 'Hb Knossos-like' beta +-thalassaemia abnormality; the A----G mutation at codon 19 likely creates an alternate splicing site between codons 17 and 18, reducing the efficiency of the normal donor splice site at IVS-I to about 60%.

Matched MeSH terms: Hemoglobins, Abnormal/genetics*
Southeast Asian Ovalocytosis and Hemoglobinopathies in Newborns: Prevalence, Molecular, and Hematologic Analyses

Yamsri S, Kawon W, Duereh A, Fucharoen G, Fucharoen S

J Pediatr Hematol Oncol, 2021 04 01;43(3):e341-e345.
PMID: 32815885 DOI: 10.1097/MPH.0000000000001920

OBJECTIVES: Southeast Asian ovalocytosis (SAO) is an inherited red blood cell (RBC) membrane disorder, whereas hemoglobinopathies are inherited globin gene disorders. In an area where both diseases are prevalent, the interaction between them resulting in variable hematologic parameters can be encountered. However, little is known about the genetic interaction of SAO and thalassemia. We investigated the prevalence of SAO and hemoglobinopathy genotypes among newborns in southern Thailand.
PATIENTS AND METHODS: This study was carried out on 297 newborns recruited consecutively at Naradhiwas Rajanagarindra Hospital in the south of Thailand. The SAO was identified on blood smear examination and polymerase chain reaction analysis. Thalassemia genotypes were defined. Hematologic parameters and hemoglobin (Hb) profiles were recorded and analyzed.
RESULTS: Among 297 newborns, 15 (5.1%) carried SAO, whereas 70 (23.6%) had thalassemia with 15 different thalassemia genotypes. Abnormal Hb including Hb C, Hb Q-Thailand, and Hb D-Punjab were observed in 5 newborns. It was found in the nonthalassemic newborns that RBC count, Hb, and hematocrit of the nonthalassemic newborns with SAO were significantly lower than those without SAO. The same finding was also observed in the thalassemic newborns; RBC count, Hb, and hematocrit of the thalassemic newborns with SAO were significantly lower than those without SAO. However, the mean corpuscular volume, mean corpuscular Hb, and RBC distribution width of the SAO-newborns were significantly higher.
CONCLUSIONS: Both SAO and hemoglobinopathy genotypes are common in southern Thailand. One should take this into consideration when evaluating neonatal anemia and other hematologic abnormalities. Identification of both genetic defects and long-term monitoring on the clinical outcome of this genetic interaction should be essential to understand the pathogenesis of these common genetic disorders in the region.

Matched MeSH terms: Hemoglobins, Abnormal/analysis; Hemoglobins, Abnormal/genetics
Phosphoglucomutase and carbonic anhydrase in West Malaysian aborigines

Welch QB, Lie-Injo Luan Eng, Bolton JM

Hum. Hered., 1972;22(1):28-37.
PMID: 4624781
Matched MeSH terms: Hemoglobins, Abnormal/analysis
Haemoglobin D trait in a Filipino family

VELLA F

Med J Malaya, 1958 Jun;12(4):602-4.
PMID: 13577152
Matched MeSH terms: Hemoglobins, Abnormal*
Abnormal haemoglobins in Malay and Nepalese Gurkhasoldiers

VELLA F, FIELD TE

Med J Malaya, 1958 Dec;13(2):153-8.
PMID: 13632213
Matched MeSH terms: Hemoglobins, Abnormal*
Iron overload in anaemia with underlying haemoglobin constant spring in an antenatal mother in primary care

Thew HZ, Ng CH, Loo CY

BMJ Case Rep, 2024 Feb 17;17(2).
PMID: 38367998 DOI: 10.1136/bcr-2023-258526

This is the case of a gravida 3 para 1 woman in her late 20s with underlying haemoglobin constant spring who visited a healthcare clinic for an antenatal check-up. Towards the end of her second trimester, she experienced lethargy. During her antenatal booking, she was diagnosed with mild asymptomatic anaemia, high serum ferritin, T saturation of 88% and abnormal liver function tests. She was referred to a hospital where an MRI scan revealed over 2 g of iron deposits in her liver, leading to a revised diagnosis of iron overload. Treatment included deferoxamine and expectant management throughout her antenatal period, and her delivery was uncomplicated. While iron deficiency anaemia is common in pregnancy, it is crucial not to overlook iron deposition and the distinction from acute fatty liver during pregnancy to prevent treatment delays.

Matched MeSH terms: Hemoglobins, Abnormal*
Fulltext Identification of αo-thalassaemia (–SEA) using an Enzyme- Linked Immunosorbent Assay (ELISA) for embryonic zeta-globin chain detection – a preliminary study

Tan, J. A. M. A., George, E., Lim, E. J., Zakaria, Z., Hassan, R., Wee, Y. C., et al.

Malaysian Journal of Medicine and Health Sciences, 2006;2(2):81-87.
MyJurnal

Objectives: This study aimed to evaluate the UBI MAGIWELTM ζ-GLOBIN ELISA Kit for the presumptive diagnosis of αo-thalassaemia. The ELISA results obtained were confirmed by molecular characterisation of αo-thalassaemia using a Duplex-PCR. Methods: Routine peripheral blood counts and red cell indices were determined in 94 blood samples sent for Hb analysis. Hb subtypes were quantified by high performance liquid chromatography (HPLC) and Hb electrophoresis conducted on agarose gel at pH 8.5. Zeta-globin chain levels were determined using the UBI MAGIWELTM ζ-GLOBIN ELISA Kit. Molecular analysis was performed using a duplex-PCR which simultaneously amplifies
a normal 136 bp sequence between the ψα−α2-globin genes and a 730 bp Southeast Asian deletion-specific sequence (–SEA) between the ψα2−θ1-globin genes. Results: Using the ELISA assay kit, 20 blood samples were presumptively identified as α-thalassaemia carriers from elevated ζ-globin chains (OD>0.3) while the remaining 74 blood samples showed OD

Matched MeSH terms: Hemoglobins, Abnormal
Transfusion-dependent thalassemia in Northern Sarawak: a molecular study to identify different genotypes in the multi-ethnic groups and the importance of genomic sequencing in unstudied populations

Tan JA, Chin SS, Ong GB, Mohamed Unni MN, Soosay AE, Gudum HR, et al.

Public Health Genomics, 2015;18(1):60-4.
PMID: 25412720 DOI: 10.1159/000368342

BACKGROUND: Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak.
METHODS: Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing.
RESULTS: Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients.
CONCLUSION: The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations.

Matched MeSH terms: Hemoglobins, Abnormal/analysis
Fulltext DNA studies are necessary for accurate patient diagnosis in compound heterozygosity for Hb Adana (HBA2:c.179>A) with deletional or nondeletional α-thalassaemia

Tan JA, Kho SL, Ngim CF, Chua KH, Goh AS, Yeoh SL, et al.

Sci Rep, 2016 06 08;6:26994.
PMID: 27271331 DOI: 10.1038/srep26994

Haemoglobin (Hb) Adana (HBA2:c.179>A) interacts with deletional and nondeletional α-thalassaemia mutations to produce HbH disorders with varying clinical manifestations from asymptomatic to severe anaemia with significant hepatosplenomegaly. Hb Adana carriers are generally asymptomatic and haemoglobin subtyping is unable to detect this highly unstable α-haemoglobin variant. This study identified 13 patients with compound heterozygosity for Hb Adana with either the 3.7 kb gene deletion (-α(3.7)), Hb Constant Spring (HbCS) (HBA2:c.427T>C) or Hb Paksé (HBA2:429A>T). Multiplex Amplification Refractory Mutation System was used for the detection of five deletional and six nondeletional α-thalassaemia mutations. Duplex-PCR was used to confirm Hb Paksé and HbCS. Results showed 84.6% of the Hb Adana patients were Malays. Using DNA studies, compound heterozygosity for Hb Adana and HbCS (α(codon 59)α/α(CS)α) was confirmed in 11 patients. A novel point in this investigation was that DNA studies confirmed Hb Paksé for the first time in a Malaysian patient (α(codon 59)α/α(Paksé)α) after nine years of being misdiagnosis with Hb Adana and HbCS (α(codon 59)α/α(CS)α). Thus, the reliance on haematology studies and Hb subtyping to detect Hb variants is inadequate in countries where thalassaemia is prevalent and caused by a wide spectrum of mutations.

Matched MeSH terms: Hemoglobins, Abnormal/genetics*
Interaction of Hb South Florida (codon 1; GTG-->ATG) and HbE, with beta-thalassemia (IVS1-1; G-->A): expression of different clinical phenotypes

Tan JA, Tan KL, Omar KZ, Chan LL, Wee YC, George E

Eur J Pediatr, 2009 Sep;168(9):1049-54.
PMID: 19034506 DOI: 10.1007/s00431-008-0877-9

INTRODUCTION: Interactions of different hemoglobin variants with thalassemia alleles can result in various clinical phenotypes. HbE-beta-thalassemia generally manifests with severe anemia where individuals exhibit beta-thalassemia major with regular blood transfusions or beta-thalassemia intermedia with periodic blood transfusions. This study presents a unique Malay family with three beta-globin gene defects-HbE, Hb South Florida, and IVS1-1 (G-->A).
MATERIALS AND METHODS: HbE activates a cryptic splice site that produces non-functional mRNAs. Hb South Florida is a rare beta-hemoglobin variant, and its interactions with other beta-thalassemia alleles have not been reported. IVS1-1 is a Mediterranean mutation that affects mRNA processing giving rise to beta(o)-thalassemia.
RESULTS AND DISCUSSION: Fifteen mutations along the beta-globin gene complex were analyzed using the amplification refractory mutation system. Hb South Florida was identified by direct sequencing using genomic DNA.
CONCLUSION: The affected child with HbE/IVS1-1 produced a beta-thalassemia major phenotype. Compound heterozygosity for Hb South Florida/IVS1-1 produced a beta-thalassemia carrier phenotype in the mother.

Matched MeSH terms: Hemoglobins, Abnormal/genetics*
Thalassemia intermedia in HbH-CS disease with compound heterozygosity for beta-thalassemia: challenges in hemoglobin analysis and clinical diagnosis

Tan JA, Kok JL, Tan KL, Wee YC, George E

Genes Genet Syst, 2009 Feb;84(1):67-71.
PMID: 19420802

Co-inheritance of alpha-thalassemia with homozygosity or compound heterozygosity for beta-thalassemia may ameliorate beta-thalassemia major. A wide range of clinical phenotypes is produced depending on the number of alpha-thalassemia alleles (-alpha/alphaalpha --/alphaalpha, --/-alpha). The co-inheritance of beta-thalassemia with alpha-thalassemia with a single gene deletion (-alpha/alphaalpha) is usually associated with thalassemia major. In contrast, the co-inheritance of beta-thalassemia with two alpha-genes deleted in cis or trans (--/alphaalpha or -alpha/-alpha) generally produces beta-thalassemia intermedia. In Southeast Asia, the most common defect responsible for alpha-thalassemia is the Southeast Asian (SEA) deletion of 20.5 kilobases. The presence of the SEA deletion with Hb Constant Spring (HbCS) produces HbH-CS disease. Co-inheritance of HbH-CS with compound heterozygosity for beta-thalassemia is very rare. This study presents a Malay patient with HbH-CS disorder and beta degrees/beta+-thalassemia. The SEA deletion was confirmed in the patient using a duplex-PCR. A Combine-Amplification Refractory Mutation System (C-ARMS) technique to simultaneously detect HbCS and Hb Quong Sze confirmed HbCS in the patient. Compound heterozygosity for CD41/42 and Poly A was confirmed using the ARMS. This is a unique case as the SEA alpha-gene deletion in cis (--SEA/alphaalpha) is generally not present in the Malays, who more commonly possess the two alpha-gene deletion in trans (-alpha/-alpha). In addition, the beta-globin gene mutation at CD41/42 is a common mutation in the Chinese and not in the Malays. The presence of both the SEA deletion and CD41/42 in the mother of the patient suggests the possible introduction of these two defects into the family by marriage with a Chinese.

Matched MeSH terms: Hemoglobins, Abnormal/genetics*
Fulltext Efficacy and tolerability of Dianex in Type 2 diabetes mellitus: a non randomized, open label non-comparative study

Sudha V, Bairy KL, Shashikiran U, Sachidananda A, Jayaprakash B, Shalini S

Med J Malaysia, 2005 Jun;60(2):204-11.
PMID: 16114162

OBJECTIVE AND STUDY DESIGN: A nonrandomized open labeled clinical trial to evaluate the efficacy and tolerability of Dianex (a poly herbal formulation developed by Apex Laboratories [PVT] Chennai, Tamil Nadu, India) in type 2 diabetes mellitus was carried out during a 6-month period.
SETTING/LOCATION: This study was conducted in TMA Pai Hospital, Udupi, South India.
SUBJECTS: A total of 40 patients were recruited for this study. Three patients dropped out of the study leaving a total of 37 patients (11 for monotherapy and 26 for add on therapy).
OUTCOME MEASURES: Eighteen (18) clinical variables were investigated, including liver enzymes, kidney function tests, hematologic parameters, blood glucose, and insulin and lipid profiles.
RESULTS: at the end of 12 weeks it was found that there was a significant decrease in the level of glycated hemoglobin, fasting plasma insulin level, insulin resistance, and systolic and diastolic blood pressure. At the end of 24 weeks results were similar to those at 12 weeks. Dianex did not alter the liver function tests, hematological parameters, or kidney function tests.
CONCLUSION: In this preliminary study, Dainex is found to be an effective adjuvant drug with either oral antidiabetic agents or insulin that can be used in the control of blood sugars in diabetic patients. Dianex is a safe drug that does not cause any clinical, hematological or biochemical alteration in major organ systems.

Matched MeSH terms: Hemoglobins, Abnormal/metabolism
Haemoglobin Ypsilanti: an incidental finding in two diabetic patients

Sthaneshwar P, Shanmugam H, Arumugam S

Pathology, 2014 Apr;46(3):263-5.
PMID: 24614705 DOI: 10.1097/PAT.0000000000000090
Matched MeSH terms: Hemoglobins, Abnormal/analysis*; Hemoglobins, Abnormal/genetics
Haemoglobin Constant Spring (HbA2: c.427T>C) and Haemoglobin Adana (HbA2: c.179G>A) in jaundiced Malaysian term neonates with clinically significant hyperbilirubinemia

Shwe S, Boo NY, Ong HK, Chee SC, Maslina M, Ling MMM, et al.

Malays J Pathol, 2020 Aug;42(2):253-257.
PMID: 32860378

INTRODUCTION: Haemoglobin Constant Spring (Hb CoSp) and Haemoglobin Adana (Hb Adana), are two non-deletion type of α-thalassemia reported in Malaysia. Owing to their structural instability, they cause hemolysis and hyperbilirubinemia. This observational study was part of a large study investigating multiple factors associated with severe neonatal jaundice. In this part we aimed to determine the prevalence of Hb CoSp and Hb Adana and their association with clinically significant neonatal hyperbilirubinemia (SigNH, total serum bilirubin (TSB>290µmol/L)) among jaundiced Malaysian term neonates.
MATERIALS AND METHODS: The inclusion criteria were normal term-gestation neonates admitted consecutively for phototherapy. PCR-restriction fragment length polymorphism method was applied on DNA extracted from dry blood spot specimens of each neonate to detect for Hb CoSp and Hb Adana gene. Positive samples were verified by gene sequencing.
RESULTS: Of the 1121 neonates recruited (719 SigNH and 402 no-SigNH), heterozygous Hb CoSp gene was detected in only two (0.27%) neonates. Both were SigNH neonates (0.3% or 2/719). No neonate had Hb Adana variant.
CONCLUSION: Hb CoSp was not common but could be a risk factor associated with SigNH. No Hb Adana was detected.

Matched MeSH terms: Hemoglobins, Abnormal/genetics*
Fulltext Rapid Targeted Next-Generation Sequencing Platform for Molecular Screening and Clinical Genotyping in Subjects with Hemoglobinopathies

Shang X, Peng Z, Ye Y, Asan, Zhang X, Chen Y, et al.

EBioMedicine, 2017 Sep;23:150-159.
PMID: 28865746 DOI: 10.1016/j.ebiom.2017.08.015

Hemoglobinopathies are among the most common autosomal-recessive disorders worldwide. A comprehensive next-generation sequencing (NGS) test would greatly facilitate screening and diagnosis of these disorders. An NGS panel targeting the coding regions of hemoglobin genes and four modifier genes was designed. We validated the assay by using 2522 subjects affected with hemoglobinopathies and applied it to carrier testing in a cohort of 10,111 couples who were also screened through traditional methods. In the clinical genotyping analysis of 1182 β-thalassemia subjects, we identified a group of additional variants that can be used for accurate diagnosis. In the molecular screening analysis of the 10,111 couples, we detected 4180 individuals in total who carried 4840 mutant alleles, and identified 186 couples at risk of having affected offspring. 12.1% of the pathogenic or likely pathogenic variants identified by our NGS assay, which were undetectable by traditional methods. Compared with the traditional methods, our assay identified an additional at-risk 35 couples. We describe a comprehensive NGS-based test that offers advantages over the traditional screening/molecular testing methods. To our knowledge, this is among the first large-scale population study to systematically evaluate the application of an NGS technique in carrier screening and molecular diagnosis of hemoglobinopathies.

Matched MeSH terms: Hemoglobins, Abnormal/genetics
Fulltext Genetic association in myocardial infarction. Ethnicity; ABO, Rh, Le, Xg blood groups; G6PD deficiency; and abnormal haemoglobins

Saha N, Toh CC, Ghosh MB

J Med Genet, 1973 Dec;10(4):340-5.
PMID: 4204387
Matched MeSH terms: Hemoglobins, Abnormal/analysis*
Fulltext Identification of hemoglobin AC heterozygote status in a Malay family: a decision between hemoglobin electrophoresis and high performance liquid chromotography

Rosline H, Roshan TM, Ahmed SA, Ilunihayati I

Southeast Asian J. Trop. Med. Public Health, 2007 May;38(3):543-5.
PMID: 17877232

Thalassemia is a common public health problem among Malays. Hemoglobin C (Hb C) is a hemoglobin beta variant resulting from a single base mutation at the 6th position of the beta-globin gene leading to the substitution of glycine for glutamic acid. Hb C is commonly detected in West Africans and in African American but has not been reported in Malaysia. It can be falsely diagnosed as HbE trait in the Malaysian Thalassemia Screening Program which utilizes cellulose acetate hemoglobin electrophoresis. This is the first reported case of Hb AC heterozygote status in a Malay family, with unusual splenomegaly in one of the family members.

Matched MeSH terms: Hemoglobins, Abnormal/analysis*
Haemoglobin E--thalassaemia in Kelantan

Poi Tzse Chiat D

Med J Malaya, 1965 Mar;19(3):184-7.
PMID: 4220470
Matched MeSH terms: Hemoglobins, Abnormal*
Fulltext Haemoglobin Lepore in a Malay family: a case report

Pasangna J, George E, Nagaratnam M

Malays J Pathol, 2005 Jun;27(1):33-7.
PMID: 16676691

A 2-year-old Malay boy was brought to the University Malaya Medical Centre for thalassaemia screening. Physical examination revealed thalassaemia facies, pallor, mild jaundice, hepatomegaly and splenomegaly. Laboratory investigations on the patient including studies on the parents lead to a presumptive diagnosis of homozygous Haemoglobin Lepore (Hb Lepore). The aim of this paper is to increase awareness of this rare disorder, this being the first case documented in Malaysia in a Malay. The case also demonstrates the need for this disorder to be included in the differential diagnosis of patients presenting clinically like thalassemia intermedia or thalassemia major. Accurate diagnosis would provide information necessary for prenatal diagnosis, proper clinical management and genetic counseling. The clinical, haematological and laboratory features of this disorder are discussed in this paper.

Matched MeSH terms: Hemoglobins, Abnormal/genetics*

Filters

Please provide feedback to Administrator (afdal@afpm.org.my)

External Links