MyMedR

Displaying publications 21 - 40 of 47 in total

Abstract:

Sort:

Fulltext Population genetic study among the Orange Asli (Semai Senoi) of Malaysia: Malayan aborigines

Saha N, Mak JW, Tay JS, Liu Y, Tan JA, Low PS, et al.

Hum Biol, 1995 Feb;67(1):37-57.
PMID: 7721278

A population genetic study was undertaken to provide gene frequency data on the additional blood genetic markers in the Semai and to estimate the genetic relations between the Semai and their neighboring and linguistically related populations by genetic distance and principal components analyses. Altogether 10 polymorphic and 7 monomorphic blood genetic markers (plasma proteins and red cell enzymes) were studied in a group of 349 Senoi Semai from 11 aboriginal settlements (villages) in the Pahang State of western Malaysia. Both the red cell glucose-6-phosphate dehydrogenase (G6PD) and 6-phosphogluconate dehydrogenase (PGD) loci reveal the presence of polymorphic frequencies of a nondeficient slow allele at the G6PD locus and a fast allele at the PGD locus. The Semai are characterized by high prevalences of ahaptoglobinemia and G6PD deficiency, high frequencies of HP*1, HB*E, RH*R1, ACP*C, GLO1*1, PGM1*2+, and GC*1F and corresponding low frequencies of ABO*A, HbCoSp, HB*B0, TF*D, CHI, and GC*2. Genetic distance analyses by both cluster and principal components models were performed between the Semai and 14 other populations (Malay; Javanese; Khmer; Veddah; Tamils of Malaysia, Sri Lanka, and India; Sinhalese; Oraon; Toda and Irula of India; Chinese; Japanese; Koreans) on the basis of 30 alleles at 7 polymorphic loci. A more detailed analysis using 53 alleles at 13 polymorphic loci with 10 populations was carried out. Both analyses give genetic evidence of a close relationship between the Semai and the Khmer of Cambodia. Furthermore, the Semai are more closely related to the Javanese than to their close neighbors--the Malay, Chinese, and Tamil Indians. There is no evidence for close genetic relationship between the Semai and the Veddah or other Indian tribes. The evidence fits well with the linguistic relationship of the Semai with the Mon-Khmer branch of the Austro-Asiatic language family.
Higher frequency of p53 gene mutations in diffuse large B-cell lymphoma with MALT component

Tai YC, Tan JA, Peh SC

Pathol. Int., 2004 Nov;54(11):811-8.
PMID: 15533223

p53 gene mutation is not a frequent event in the tumorigenesis of lymphomas and the expression of p53 protein is independent of p53 gene mutations. The present study aimed to investigate mutations in the p53 gene in a series of extranodal B-cell lymphomas, and its association with p53 protein expression. A total of 52 cases were graded histologically into Grade 1, Grade 2 and Grade 3 tumors and p53 protein expression was detected using immunohistochemistry. Mutations in the p53 gene were analyzed using polymerase chain reaction single-strand conformation polymorphism (PCR-SSCP) and mobility shifts were confirmed by direct sequencing. The tumors comprised 26 (50%) Grade 1, 9 (17%) Grade 2 and 15 (29%) Grade 3. A high proportion of Grade 2 (25%) tumors expressed p53 protein (P = 0.051) and carried p53 gene mutation (33%) (P = 0.218). However, p53 protein expression was not associated with p53 gene mutations (P = 0.057). Transversion mutations (88%) were more frequently detected than transition mutations (12%). The present study revealed that p53 gene mutations and p53 protein expression occurred in higher frequencies in Grade 2 tumors, which may be of pathogenetic importance. The high frequency of transversion mutations may reflect the influence of an etiological agent in the tumorigenesis of mucosa-associated lymphoid tissue (MALT lymphoma).
18q21 Rearrangement and trisomy 3 in extranodal B-cell lymphomas: a study using a fluorescent in situ hybridisation technique

Tai YC, Tan JA, Peh SC

Virchows Arch., 2004 Nov;445(5):506-14.
PMID: 15365830

t(11;18)(q21;q21) Translocation and trisomy 3 are the most common chromosomal aberrations reported in low-grade mucosa-associated lymphoid tissue (MALT) lymphoma. The current study aims to investigate the frequency of these chromosomal aberrations in a series of 52 extranodal B-cell lymphomas. The tumours were categorised into three histological grades: grade 1 (low-grade lymphoma of MALT type), grade 2 [diffuse large B-cell lymphoma (DLBCL) with MALT component] and grade 3 (DLBCL without MALT component). Fluorescence in situ hybridisation analyses on paraffin tissue sections were performed using a locus-specific probe for the 18q21 region and a centromeric probe for chromosome 3. The 18q21 rearrangement was detected in 9 of 40 (23%) cases, including 7 of 23 (30%) grade-1 and 2 of 11 (18%) grade-3 tumours. Amplification of the 18q21 region was detected in 10 of 40 (25%) cases, and trisomy 3 was detected in 9 of 34 (26%) cases. Amplification of the 18q21 region may be an important alternative pathogenetic pathway in MALT lymphoma and was found almost exclusively in tumours without 18q21 rearrangement. Our study showed that tumours with 18q21 rearrangement and 18q21 amplification develop along two distinct pathways, and the latter was more likely to transform into high-grade tumours upon acquisition of additional genetic alterations, such as trisomy 3. Trisomy 3 was more frequently found in coexistence with 18q21 abnormalities, suggesting that it was more likely to be a secondary aberration.
Transfusion-dependent thalassemia in Northern Sarawak: a molecular study to identify different genotypes in the multi-ethnic groups and the importance of genomic sequencing in unstudied populations

Tan JA, Chin SS, Ong GB, Mohamed Unni MN, Soosay AE, Gudum HR, et al.

Public Health Genomics, 2015;18(1):60-4.
PMID: 25412720 DOI: 10.1159/000368342

BACKGROUND: Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak.
METHODS: Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing.
RESULTS: Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients.
CONCLUSION: The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations.
Fulltext DNA studies are necessary for accurate patient diagnosis in compound heterozygosity for Hb Adana (HBA2:c.179>A) with deletional or nondeletional α-thalassaemia

Tan JA, Kho SL, Ngim CF, Chua KH, Goh AS, Yeoh SL, et al.

Sci Rep, 2016 06 08;6:26994.
PMID: 27271331 DOI: 10.1038/srep26994

Haemoglobin (Hb) Adana (HBA2:c.179>A) interacts with deletional and nondeletional α-thalassaemia mutations to produce HbH disorders with varying clinical manifestations from asymptomatic to severe anaemia with significant hepatosplenomegaly. Hb Adana carriers are generally asymptomatic and haemoglobin subtyping is unable to detect this highly unstable α-haemoglobin variant. This study identified 13 patients with compound heterozygosity for Hb Adana with either the 3.7 kb gene deletion (-α(3.7)), Hb Constant Spring (HbCS) (HBA2:c.427T>C) or Hb Paksé (HBA2:429A>T). Multiplex Amplification Refractory Mutation System was used for the detection of five deletional and six nondeletional α-thalassaemia mutations. Duplex-PCR was used to confirm Hb Paksé and HbCS. Results showed 84.6% of the Hb Adana patients were Malays. Using DNA studies, compound heterozygosity for Hb Adana and HbCS (α(codon 59)α/α(CS)α) was confirmed in 11 patients. A novel point in this investigation was that DNA studies confirmed Hb Paksé for the first time in a Malaysian patient (α(codon 59)α/α(Paksé)α) after nine years of being misdiagnosis with Hb Adana and HbCS (α(codon 59)α/α(CS)α). Thus, the reliance on haematology studies and Hb subtyping to detect Hb variants is inadequate in countries where thalassaemia is prevalent and caused by a wide spectrum of mutations.
T cell receptor beta chain RFLP in Chinese, Indians and Malays from Singapore

Tan JA, Tay JS, Aziz NB, Saha N

Hum. Hered., 1996 Jul-Aug;46(4):236-8.
PMID: 8807327

Restriction fragment length polymorphism (RFLP) of the gene encoding the beta chain of the human T cell receptor (TcR) was studied in three ethnic groups in Singapore by Southern blotting. Polymorphism in the beta chain gene was identified in BglII-digested DNA samples using a 770-bp TcR beta cDNA clone containing the joining and constant region segments. The TcR beta/BglII polymorphism was studied in 136 Chinese, 93 Indian and 88 Malay samples. The frequency of the less frequent allele (TcR beta*2) in all the ethnic groups was significantly lower (0.15-0.29, p < 0.01) than that in the Caucasians (0.46). Indians had a significantly lower frequency of this allele (0.15) than the Chinese (0.29) and Malays (0.26).
BamH1 polymorphism in the Chinese, Malays, and Indians in Singapore and its application in the prenatal diagnosis of beta-thalassemia

Tan JA, Tay SH, Kham KY, Wong HB

Jpn. J. Hum. Genet., 1993 Sep;38(3):315-8.
PMID: 7903173 DOI: 10.1007/BF01874141

The distribution of restriction fragment length polymorphism (RFLP) at the BamH1 site of the beta-globin gene was investigated in the Chinese, Indian, and Malay race in Singapore. The sample comprised of 183 normal individuals and 35 beta-thalassemia carriers in which 13 were couples with at least one beta-major child. The results from this study indicate that BamH1 polymorphism will be informative in 22% of pregnancies at risk for beta-thalassemia major in Chinese, 19% in Malays and 7% in Indians. In prenatal diagnosis using BamH1 polymorphism for one beta-major affected family, the fetus was diagnosed to be normal or beta-carrier. The validity of BamH1 polymorphism in the exclusion of beta-thalassemia major was subsequently confirmed at birth by globin chain biosynthesis.
Interaction of Hb South Florida (codon 1; GTG-->ATG) and HbE, with beta-thalassemia (IVS1-1; G-->A): expression of different clinical phenotypes

Tan JA, Tan KL, Omar KZ, Chan LL, Wee YC, George E

Eur J Pediatr, 2009 Sep;168(9):1049-54.
PMID: 19034506 DOI: 10.1007/s00431-008-0877-9

INTRODUCTION: Interactions of different hemoglobin variants with thalassemia alleles can result in various clinical phenotypes. HbE-beta-thalassemia generally manifests with severe anemia where individuals exhibit beta-thalassemia major with regular blood transfusions or beta-thalassemia intermedia with periodic blood transfusions. This study presents a unique Malay family with three beta-globin gene defects-HbE, Hb South Florida, and IVS1-1 (G-->A).
MATERIALS AND METHODS: HbE activates a cryptic splice site that produces non-functional mRNAs. Hb South Florida is a rare beta-hemoglobin variant, and its interactions with other beta-thalassemia alleles have not been reported. IVS1-1 is a Mediterranean mutation that affects mRNA processing giving rise to beta(o)-thalassemia.
RESULTS AND DISCUSSION: Fifteen mutations along the beta-globin gene complex were analyzed using the amplification refractory mutation system. Hb South Florida was identified by direct sequencing using genomic DNA.
CONCLUSION: The affected child with HbE/IVS1-1 produced a beta-thalassemia major phenotype. Compound heterozygosity for Hb South Florida/IVS1-1 produced a beta-thalassemia carrier phenotype in the mother.
Characterisation and confirmation of rare beta-thalassaemia mutations in the Malay, Chinese and Indian ethnic groups in Malaysia

Tan JA, Chin PS, Wong YC, Tan KL, Chan LL, George E

Pathology, 2006 Oct;38(5):437-41.
PMID: 17008283

In Malaysia, about 4.5% of the Malay and Chinese populations are heterozygous carriers of beta-thalassaemia. The initial identification of rare beta-globin gene mutations by genomic sequencing will allow the development of simpler and cost-effective PCR-based techniques to complement the existing amplification refractory mutation system (ARMS) and gap-PCR used for the identification of beta-thalassaemia mutations.
Thalassemia intermedia in HbH-CS disease with compound heterozygosity for beta-thalassemia: challenges in hemoglobin analysis and clinical diagnosis

Tan JA, Kok JL, Tan KL, Wee YC, George E

Genes Genet Syst, 2009 Feb;84(1):67-71.
PMID: 19420802

Co-inheritance of alpha-thalassemia with homozygosity or compound heterozygosity for beta-thalassemia may ameliorate beta-thalassemia major. A wide range of clinical phenotypes is produced depending on the number of alpha-thalassemia alleles (-alpha/alphaalpha --/alphaalpha, --/-alpha). The co-inheritance of beta-thalassemia with alpha-thalassemia with a single gene deletion (-alpha/alphaalpha) is usually associated with thalassemia major. In contrast, the co-inheritance of beta-thalassemia with two alpha-genes deleted in cis or trans (--/alphaalpha or -alpha/-alpha) generally produces beta-thalassemia intermedia. In Southeast Asia, the most common defect responsible for alpha-thalassemia is the Southeast Asian (SEA) deletion of 20.5 kilobases. The presence of the SEA deletion with Hb Constant Spring (HbCS) produces HbH-CS disease. Co-inheritance of HbH-CS with compound heterozygosity for beta-thalassemia is very rare. This study presents a Malay patient with HbH-CS disorder and beta degrees/beta+-thalassemia. The SEA deletion was confirmed in the patient using a duplex-PCR. A Combine-Amplification Refractory Mutation System (C-ARMS) technique to simultaneously detect HbCS and Hb Quong Sze confirmed HbCS in the patient. Compound heterozygosity for CD41/42 and Poly A was confirmed using the ARMS. This is a unique case as the SEA alpha-gene deletion in cis (--SEA/alphaalpha) is generally not present in the Malays, who more commonly possess the two alpha-gene deletion in trans (-alpha/-alpha). In addition, the beta-globin gene mutation at CD41/42 is a common mutation in the Chinese and not in the Malays. The presence of both the SEA deletion and CD41/42 in the mother of the patient suggests the possible introduction of these two defects into the family by marriage with a Chinese.
Molecular defects in the beta-globin gene identified in different ethnic groups/populations during prenatal diagnosis for beta-thalassemia: a Malaysian experience

Tan JA, George E, Tan KL, Chow T, Tan PC, Hassan J, et al.

Clin Exp Med, 2004 Dec;4(3):142-7.
PMID: 15599663 DOI: 10.1007/s10238-004-0048-x

Beta-thalassemia is the most-common genetic disorder of hemoglobin synthesis in Malaysia, and about 4.5% of the population are heterozygous carriers of the disorder. Prenatal diagnosis was performed for 96 couples using the Amplification Refractory Mutation System and Gap-Polymerase Chain Reaction. We identified 17 beta-globin defects-initiation codon for translation (T-G), -29 (A-G), -28 (A-G), CAP +1 (A-C), CD 8/9 (+G), CD 15 (G-A), CD 17 (A-T), CD 19 (A-G), Hb E (G-A), IVS1-1 (G-T), IVS1-5 (G-C), CD 41/42 (-CTTT), CD 71-72 (+A), IVS2-654 (CT), poly A(A-G), 100-kb Ggamma(Agammadeltabeta) degrees and 45-kb Filipino deletions. The 192 beta-alleles studied comprised Chinese (151 patients), Malay (21), Orang Asli from East Malaysia (15), Filipino (1), Indian (1), Indonesian Chinese (2), and Thai (1). In the Chinese, 2 beta-globin defects at CD 41/42 and IVS2-654 were responsible for 74% of beta-thalassemia. beta-mutations at CD 19, IVS1-1 (G-T), IVS1-5, poly A, and hemoglobin E caused 76% of the hemoglobin disorders in the Malays. The Filipino 45-kb deletion caused 73.3% of bthalassemia in the Orang Asli. Using genomic sequencing, the rare Chinese beta-mutation at CD 43 (G-T) was confirmed in 2 Chinese, and the Mediterranean mutation IVS1-1 (G-A) was observed in a Malay beta-thalassemia carrier. The beta-globin mutations confirmed in this prenatal diagnosis study were heterogenous and 65 (68%) couples showed a different globin defect from each other. The use of specific molecular protocols has allowed rapid and successful prenatal diagnosis of beta-thalassemia in Malaysia.
Fulltext Orbital Exenteration and Reconstruction Using a Free Radial Forearm Flap in Conjunctival Melanoma: Old but Gold

Tan JA, Khoo ET, Al-Chalabi MMM, Mohd Zainal H, Wan Sulaiman WA

Cureus, 2023 Jul;15(7):e42572.
PMID: 37637587 DOI: 10.7759/cureus.42572

Conjunctival melanoma is a rare and potentially deadly tumor. Therefore, adequate oncological resection is essential, commonly leading to total orbital exenteration, which causes patients' extensive functional and cosmetic impairment. As a result, it is essential to reconstruct the orbital region post-exenteration to obliterate the cavity, provide adequate and pliable cutaneous covering, and restore a stable vascularized tissue that can withstand adjuvant radiotherapy. In recent years, the techniques used for orbital reconstruction have included the transorbital temporoparietal fascial flap, the anterolateral thigh flap, and local flaps, such as the paramedian forehead flap. A free radial forearm flap is currently not commonly used for orbital reconstruction due to potential donor site morbidity and cosmetic issues. In our case, we report a free radial forearm fasciocutaneous flap that has been utilized with promising surgical outcomes to reconstruct the orbital region following orbital exenteration.
Fulltext High prevalence of alpha- and beta-thalassemia in the Kadazandusuns in East Malaysia: challenges in providing effective health care for an indigenous group

Tan JA, Lee PC, Wee YC, Tan KL, Mahali NF, George E, et al.

J Biomed Biotechnol, 2010;2010.
PMID: 20871816 DOI: 10.1155/2010/706872

Thalassemia can lead to severe transfusion-dependent anemia, and it is the most common genetic disorder in Malaysia. This paper aims to determine the prevalence of thalassemia in the Kadazandusuns, the largest indigenous group in Sabah, East Malaysia. α- and β-thalassemia were confirmed in 33.6% and 12.8%, of the individuals studied respectively. The high prevalence of α- and β-thalassemia in the Kadazandusuns indicates that thalassemia screening, genetic counseling, and prenatal diagnosis should be included as part of their healthcare system. This preliminary paper serves as a baseline for further investigations into the health and genetic defects of the major indigenous population in Sabah, East Malaysia.
Combine-ARMS: a rapid and cost-effective protocol for molecular characterization of beta-thalassemia in Malaysia

Tan KL, Tan JA, Wong YC, Wee YC, Thong MK, Yap SF

Genet. Test., 2001;5(1):17-22.
PMID: 11336396 DOI: 10.1089/109065701750168626

Beta-thalassemia major patients have chronic anemia and are dependent on blood transfusions to sustain life. Molecular characterization and prenatal diagnosis of beta3-thalassemia is essential in Malaysia because about 4.5% of the population are heterozygous carriers for beta-thalassemia. The high percentage of compound heterozygosity (47.62%) found in beta-thalassemia major patients in the Thalassaemia Registry, University of Malaya Medical Centre (UMMC), Malaysia, also supports a need for rapid, economical, and sensitive protocols for the detection of beta-thalassemia mutations. Molecular characterization of beta-thalassemia mutations in Malaysia is currently carried out using ARMS, which detects a single beta-thalassemia mutation per PCR reaction. We developed and evaluated Combine amplification refractory mutation system (C-ARMS) techniques for efficient molecular detection of two to three beta-thalassemia mutations in a single PCR reaction. Three C-ARMS protocols were evaluated and established for molecular characterization of common beta-thalassemia mutations in the Malay and Chinese ethnic groups in Malaysia. Two C-ARMS protocols (cd 41-42/IVSII #654 and -29/cd 71-72) detected the beta-thalassemia mutations in 74.98% of the Chinese patients studied. The CARMS for cd 41-42/IVSII #654 detected beta-thalassemia mutations in 72% of the Chinese families. C-ARMS for cd 41-42/IVSI #5/cd 17 allowed detection of beta-thalassemia mutations in 36.53% of beta-thalassemia in the Malay patients. C-ARMS for cd 41-42/IVSI #5/cd 17 detected beta-thalassemia in 45.54% of the Chinese patients. We conclude that C-ARMS with the ability to detect two to three mutations in a single reaction provides more rapid and cost-effective protocols for beta-thalassemia prenatal diagnosis and molecular analysis programs in Malaysia.
The use of Taqman genotyping assays for rapid confirmation of β-thalassaemia mutations in the Malays: accurate diagnosis with low DNA concentrations

Teh LK, Lee TY, Tan JA, Lai MI, George E

Int J Lab Hematol, 2015 Feb;37(1):79-89.
PMID: 24725998 DOI: 10.1111/ijlh.12240

In Malaysia, β-thalassaemia is a common inherited blood disorder in haemoglobin synthesis with a carrier rate of 4.5%. Currently, PCR-incorporating techniques such as amplification refractory mutation system (ARMS) or reverse dot blot hybridization (RDBH) are used in β-thalassaemia mutation detection. ARMS allows single-mutation identification using two reactions, one for wild type and another for mutant alleles. RDBH requires probe immobilization and optimization of hybridization and washing temperatures which is time consuming. The aim of our study was to investigate whether β-thalassaemia mutations can be identified in samples with low DNA concentrations.
Molecular basis of transfusion dependent beta-thalassemia major patients in Sabah

Teh LK, George E, Lai MI, Tan JA, Wong L, Ismail P

J Hum Genet, 2014 Mar;59(3):119-23.
PMID: 24369358 DOI: 10.1038/jhg.2013.131

Beta-thalassemia is one of the most prevalent inherited diseases and a public health problem in Malaysia. Malaysia is geographically divided into West and East Malaysia. In Sabah, a state in East Malaysia, there are over 1000 estimated cases of β-thalassemia major patients. Accurate population frequency data of the molecular basis of β-thalassemia major are needed for planning its control in the high-risk population of Sabah. Characterization of β-globin gene defects was done in 252 transfusion dependent β-thalassemia patients incorporating few PCR techniques. The study demonstrates that β-thalassemia mutations inherited are ethnically dependent. It is important to note that 86.9% of transfusion-dependent β-thalassemia major patients in Sabah were of the indigenous population and homozygous for a single mutation. The Filipino β(0)-deletion was a unique mutation found in the indigenous population of Sabah. Mutations common in West Malaysia were found in 11 (4.3%) patients. Four rare mutations (Hb Monroe, CD 8/9, CD 123/124/125 and IVS I-2) were also found. This study is informative on the population genetics of β-thalassemia major in Sabah.
Fulltext Assessment of Risk and Sero-Prevalence of Helicobacter pylori Colonization among Remote Orang Asli Tribes in Peninsula Malaysia

Thevakumar K, Chandren JR, Perez-Perez GI, Chua EG, Teh LK, Salleh MZ, et al.

PLoS One, 2016;11(7):e0159830.
PMID: 27441568 DOI: 10.1371/journal.pone.0159830

The epidemiology of Helicobacter pylori (H. pylori) infection is related to human poverty with marked differences between developing and developed countries. Socioeconomic factors and living standards are the main determinants of the age-dependent acquisition rate of H. pylori, and consequently its prevalence. The aim of this study was to assess the risk and sero-prevalence of H. pylori colonization among Orang Asli in Peninsula Malaysia. This cross-sectional study was conducted on Orang Asli subjects in seven isolated settlements spanning across all three major tribes (Negrito, Proto Malay and Senoi) in Malaysia. Socio-demographic characteristics of the subjects were obtained through interview. Subjects were tested for H. pylori colonization based on CagA and whole cell (WC) antigen serological assays. A total of 275 subjects participated in this study. Among these subjects, 115 (44.7%) were H. pylori sero-positive with highest sero-prevalence among Negrito (65.7%). Among subjects who were H. pylori sero-positive, CagA sero positivity was also significantly higher among Negrito. The highest proportion of respondents reported to be H. pylori sero-positive was from age group 30 years old and below (57.9%), males (56.2%), Negrito (48.6%) and live in bamboo house (92.3%). The highest proportion of respondents reported to be CagA sero-positive was from age group 30 years old and below (41.4%), males (35.6%) and Negrito (48.6%). The results of this study demonstrate that H. pylori colonization can be related to age, gender, tribes and house materials and CagA sero-positive stain closely associated with age, gender and tribes.
Fulltext Characterisation of beta-globin gene mutations in Malaysian children: a strategy for the control of beta-thalassaemia in a developing country

Thong MK, Tan JA, Tan KL, Yap SF

J Trop Pediatr, 2005 Dec;51(6):328-33.
PMID: 15967770 DOI: 10.1093/tropej/fmi052

beta-thalassaemia major, an autosomal recessive hemoglobinopathy, is one of the most common single gene disorders in multi-racial Malaysia. The control of beta-thalassaemia major requires a multi-disciplinary approach that includes population screening, genetic counselling, prenatal diagnosis and the option of termination of affected pregnancies. To achieve this objective, the molecular characterisation of the spectrum of beta-globin gene mutations in each of the affected ethnic groups is required. We studied 88 consecutive unrelated individuals and their respective families with beta-thalassaemia (74 beta-thalassaemia major, 12 HbE-beta-thalassaemia, 2 with HbE homozygotes) and four individuals with beta-thalassaemia trait that contributed a total 180 alleles for study. Using a 2-step molecular diagnostic strategy consisting of amplification refractory mutation system (ARMS) to identify the 8 most common mutations followed by other DNA-based diagnostic techniques, a total of 177 (98.3 per cent) of the 180 beta-thalassaemia alleles were characterised. One out of 91 (1 per cent) of the Chinese alleles, one out of 46 (2.2 per cent) Malay alleles and one out of two Indian alleles remained unknown. A 100 per cent success rate was achieved in studying the Kadazandusun community in this study. A strategy to identify beta-globin gene mutations in Malaysians with beta-thalassaemia is proposed based on this outcome.
A single, large deletion accounts for all the beta-globin gene mutations in twenty families from Sabah (North Borneo), Malaysia. Mutation in brief no. 240. Online

Thong MK, Rudzki Z, Hall J, Tan JA, Chan LL, Yap SF

Hum Mutat, 1999;13(5):413.
PMID: 10338100 DOI: 10.1002/(SICI)1098-1004(1999)13:5<413::AID-HUMU15>

Beta-thalassemia major is one of the commonest genetic disorders in South-East Asia. The spectrum of beta-thalassemia mutations in the various ethnic sub-populations on the island of Borneo is unknown. We studied 20 Dusun children from the East Malaysian state of Sabah (North Borneo) with a severe beta-thalassemia major phenotype, using a combination of Southern analysis, polymerase chain reaction analysis and direct sequencing. We found the children to be homozygous for a large deletion, which has a 5' breakpoint at position -4279 from the cap site of the beta-globin gene (HBB) with the 3' breakpoint located in a L1 family of repetitive sequences at an unknown distance from the beta-globin gene. This was similar to a recent finding of a large deletion causing beta-thalassemia first described in unrelated beta-thalassemia heterozygotes of Filipino descent. This report describes the first 20 families with homozygosity of the deletion causing a severe phenotype. It provides the first information on the molecular epidemiology of beta-thalassemia in Sabah. This finding has implications for the population genetics and preventative strategies for beta-thalassemia major for nearly 300 million individuals in South-East Asia.
Alpha-thalassaemia in association with beta-thalassaemia patients in Malaysia: a study on the co-inheritance of both disorders

Wee YC, Tan KL, Kuldip K, Tai KS, George E, Tan PC, et al.

Community Genet, 2008;11(3):129-34.
PMID: 18376108 DOI: 10.1159/000113874

BACKGROUND/AIMS: Individuals with double heterozygosity for alpha- and beta-thalassaemia and heterozygous beta-thalassaemia show a similar haematological picture. Co-inheritance of alpha- and beta-thalassaemia in both partners may result in pregnancies with either Hb Bart's hydrops foetalis or beta-thalassaemia major, or pregnancies with both disorders.
METHODS: The co-inheritance of alpha-thalassaemia in 322 beta-thalassaemia carriers in Malaysia was studied.
RESULTS: The frequency of alpha-thalassaemia in the beta-thalassaemia carriers was 12.7% (41/322), with a carrier frequency of 7.8% for the SEA deletion, 3.7% for the -alpha(3.7) deletion, 0.9% for Hb Constant Spring and 0.3% for the -alpha(4.2) deletion.
CONCLUSION: Double heterozygosity for alpha- and beta-thalassaemia was confirmed in 5 out of the 41 couples and the risk of the fatal condition Hb Bart's hydrops foetalis was confirmed in two of these couples. Detection of the Southeast Asian (SEA) deletion in the Malaysian Malays in this study confirms that Hb Bart's hydrops foetalis can occur in this ethnic group. Results of this study have provided new information on the frequency and different types of alpha-thalassaemia (--(SEA), -alpha(3.7) and -alpha(4.2) deletions, Hb Constant Spring) in Malaysian beta-thalassaemia carriers.

Filters

Please provide feedback to Administrator (afdal@afpm.org.my)

External Links