Displaying publications 21 - 40 of 47 in total

Abstract:
Sort:
  1. Wong LP, George E, Tan JA
    J Community Genet, 2011 Jun;2(2):71-9.
    PMID: 22109791 DOI: 10.1007/s12687-011-0039-z
    Hemoglobin disorders which include thalassemias are the most common heritable disorders. Effective treatment is available, and these disorders can be avoided as identification of carriers is achievable using simple hematological tests. An in-depth understanding of the awareness, attitudes, perceptions, and screening reservations towards thalassemia is necessary, as Malaysia has a multi-ethnic population with different religious beliefs. A total of 13 focus group discussions (70 participants) with members of the general lay public were conducted between November 2008 and January 2009. Lack of knowledge and understanding about thalassemia leads to general confusions over differences between thalassemia carriers and thalassemia major, inheritance patterns, and the physical and psychologically impact of the disorder in affected individuals and their families. Although most of the participants have not been tested for thalassemia, a large majority expressed willingness to be screened. Views on prenatal diagnosis and termination of fetuses with thalassemia major received mixed opinions from participants with different religions and practices. Perceived stigma and discrimination attached to being a carrier emerged as a vital topic in some group discussions where disparity in the answers exhibited differences in levels of participants' literacy and ethnic origins. The two most common needs identified from the discussion were information and screening facilities. Participants' interest in knowing the severity of the disease and assessing their risk of getting the disorder may imply the health belief model as a possible means of predicting thalassemia public screening services. Findings provide valuable insights for the development of more effective educational, screening, and prenatal diagnostic services in the multi-ethnic Asian society.
  2. Ariffin MH, Mohd-Mahdi SN, Baharudin A, M Tamil A, Abdul-Rhani S, Ibrahim K, et al.
    Malays Orthop J, 2023 Jul;17(2):35-42.
    PMID: 37583520 DOI: 10.5704/MOJ.2307.006
    INTRODUCTION: To investigate the use of a tubular retractor to provide access to the craniovertebral junction (CVJ) sparing the soft palate with the aim of reducing complications associated with traditional transoral approach but yet allowing adequate decompression of the CVJ.

    MATERIALS AND METHODS: Twelve consecutive patients with severe myelopathy (JOA-score less than 11) from ventral CVJ compression were operated between 2014-2020 using a tubular retractor assisted transoral decompression.

    RESULTS: All patients improved neurologically statistically (p=0.02). There were no posterior pharynx wound infections or rhinolalia. There was one case with incomplete removal of the lateral wall of odontoid and one incidental durotomy.

    CONCLUSIONS: A Tubular retractor provides adequate access for decompression of the ventral compression of CVJ. As the tubular retractor pushed away the uvula, soft palate and pillars of the tonsils as it docked on the posterior pharyngeal wall, the traditional complications associated with traditional transoral procedures is completely avoided.

  3. Puah SM, Chua KH, Tan JA
    Int J Environ Res Public Health, 2016 Feb;13(2):199.
    PMID: 26861367 DOI: 10.3390/ijerph13020199
    Staphylococcus aureus is one of the leading causes of food poisoning. Its pathogenicity results from the possession of virulence genes that produce different toxins which result in self-limiting to severe illness often requiring hospitalization. In this study of 200 sushi and sashimi samples, S. aureus contamination was confirmed in 26% of the food samples. The S. aureus isolates were further characterized for virulence genes and antibiotic susceptibility. A high incidence of virulence genes was identified in 96.2% of the isolates and 20 different virulence gene profiles were confirmed. DNA amplification showed that 30.8% (16/52) of the S. aureus carried at least one SE gene which causes staphylococcal food poisoning. The most common enterotoxin gene was seg (11.5%) and the egc cluster was detected in 5.8% of the isolates. A combination of hla and hld was the most prevalent coexistence virulence genes and accounted for 59.6% of all isolates. Antibiotic resistance studies showed tetracycline resistance to be the most common at 28.8% while multi-drug resistance was found to be low at 3.8%. In conclusion, the high rate of S. aureus in the sampled sushi and sashimi indicates the need for food safety guidelines.
  4. Wee YC, Tan KL, Chua KH, George E, Tan JA
    Malays J Med Sci, 2009 Jul;16(3):21-8.
    PMID: 22589661 MyJurnal
    BACKGROUND: The interaction of the non-deletional α(+)-thalassaemia mutations Haemoglobin Constant Spring and Haemoglobin Quong Sze with the Southeast Asian double α-globin gene deletion results in non-deletional Haemoglobin H disease. Accurate detection of non-deletional Haemoglobin H disease, which is associated with severe phenotypes, is necessary as these mutations have been confirmed in the Malaysian population.
    METHODS: DNA from two families with Haemoglobin H disease was extracted from EDTA-anticoagulated whole blood and subjected to molecular analysis for α-thalassaemia. A duplex polymerase chain reaction was used to detect the Southeast Asian α-globin gene deletion. Polymerase chain reaction-restriction fragment length polymorphism analysis was then carried out to determine the presence of Haemoglobin Constant Spring and Haemoglobin Quong Sze. A combine-amplification refractory mutation system protocol was optimised and implemented for the rapid and specific molecular characterisation of Haemoglobin Constant Spring and Haemoglobin Quong Sze in a single polymerase chain reaction.
    RESULTS AND CONCLUSIONS: The combine-amplification refractory mutation system for Haemoglobin Constant Spring and Haemoglobin Quong Sze, together with the duplex polymerase chain reaction, provides accurate pre- and postnatal diagnosis of non-deletional Haemoglobin H disease and allows detailed genotype analyses using minimal quantities of DNA.
    KEYWORDS: Combine-ARMS; Hb Constant Spring; Hb Quong Sze; medical sciences
  5. Saha N, Mak JW, Tay JS, Liu Y, Tan JA, Low PS, et al.
    Hum Biol, 1995 Feb;67(1):37-57.
    PMID: 7721278
    A population genetic study was undertaken to provide gene frequency data on the additional blood genetic markers in the Semai and to estimate the genetic relations between the Semai and their neighboring and linguistically related populations by genetic distance and principal components analyses. Altogether 10 polymorphic and 7 monomorphic blood genetic markers (plasma proteins and red cell enzymes) were studied in a group of 349 Senoi Semai from 11 aboriginal settlements (villages) in the Pahang State of western Malaysia. Both the red cell glucose-6-phosphate dehydrogenase (G6PD) and 6-phosphogluconate dehydrogenase (PGD) loci reveal the presence of polymorphic frequencies of a nondeficient slow allele at the G6PD locus and a fast allele at the PGD locus. The Semai are characterized by high prevalences of ahaptoglobinemia and G6PD deficiency, high frequencies of HP*1, HB*E, RH*R1, ACP*C, GLO1*1, PGM1*2+, and GC*1F and corresponding low frequencies of ABO*A, HbCoSp, HB*B0, TF*D, CHI, and GC*2. Genetic distance analyses by both cluster and principal components models were performed between the Semai and 14 other populations (Malay; Javanese; Khmer; Veddah; Tamils of Malaysia, Sri Lanka, and India; Sinhalese; Oraon; Toda and Irula of India; Chinese; Japanese; Koreans) on the basis of 30 alleles at 7 polymorphic loci. A more detailed analysis using 53 alleles at 13 polymorphic loci with 10 populations was carried out. Both analyses give genetic evidence of a close relationship between the Semai and the Khmer of Cambodia. Furthermore, the Semai are more closely related to the Javanese than to their close neighbors--the Malay, Chinese, and Tamil Indians. There is no evidence for close genetic relationship between the Semai and the Veddah or other Indian tribes. The evidence fits well with the linguistic relationship of the Semai with the Mon-Khmer branch of the Austro-Asiatic language family.
  6. Tan JA, Tay JS, Aziz NB, Saha N
    Hum. Hered., 1996 Jul-Aug;46(4):236-8.
    PMID: 8807327
    Restriction fragment length polymorphism (RFLP) of the gene encoding the beta chain of the human T cell receptor (TcR) was studied in three ethnic groups in Singapore by Southern blotting. Polymorphism in the beta chain gene was identified in BglII-digested DNA samples using a 770-bp TcR beta cDNA clone containing the joining and constant region segments. The TcR beta/BglII polymorphism was studied in 136 Chinese, 93 Indian and 88 Malay samples. The frequency of the less frequent allele (TcR beta*2) in all the ethnic groups was significantly lower (0.15-0.29, p < 0.01) than that in the Caucasians (0.46). Indians had a significantly lower frequency of this allele (0.15) than the Chinese (0.29) and Malays (0.26).
  7. Tai YC, Tan JA, Peh SC
    Pathol. Int., 2004 Nov;54(11):811-8.
    PMID: 15533223
    p53 gene mutation is not a frequent event in the tumorigenesis of lymphomas and the expression of p53 protein is independent of p53 gene mutations. The present study aimed to investigate mutations in the p53 gene in a series of extranodal B-cell lymphomas, and its association with p53 protein expression. A total of 52 cases were graded histologically into Grade 1, Grade 2 and Grade 3 tumors and p53 protein expression was detected using immunohistochemistry. Mutations in the p53 gene were analyzed using polymerase chain reaction single-strand conformation polymorphism (PCR-SSCP) and mobility shifts were confirmed by direct sequencing. The tumors comprised 26 (50%) Grade 1, 9 (17%) Grade 2 and 15 (29%) Grade 3. A high proportion of Grade 2 (25%) tumors expressed p53 protein (P = 0.051) and carried p53 gene mutation (33%) (P = 0.218). However, p53 protein expression was not associated with p53 gene mutations (P = 0.057). Transversion mutations (88%) were more frequently detected than transition mutations (12%). The present study revealed that p53 gene mutations and p53 protein expression occurred in higher frequencies in Grade 2 tumors, which may be of pathogenetic importance. The high frequency of transversion mutations may reflect the influence of an etiological agent in the tumorigenesis of mucosa-associated lymphoid tissue (MALT lymphoma).
  8. Tai YC, Tan JA, Peh SC
    Virchows Arch., 2004 Nov;445(5):506-14.
    PMID: 15365830
    t(11;18)(q21;q21) Translocation and trisomy 3 are the most common chromosomal aberrations reported in low-grade mucosa-associated lymphoid tissue (MALT) lymphoma. The current study aims to investigate the frequency of these chromosomal aberrations in a series of 52 extranodal B-cell lymphomas. The tumours were categorised into three histological grades: grade 1 (low-grade lymphoma of MALT type), grade 2 [diffuse large B-cell lymphoma (DLBCL) with MALT component] and grade 3 (DLBCL without MALT component). Fluorescence in situ hybridisation analyses on paraffin tissue sections were performed using a locus-specific probe for the 18q21 region and a centromeric probe for chromosome 3. The 18q21 rearrangement was detected in 9 of 40 (23%) cases, including 7 of 23 (30%) grade-1 and 2 of 11 (18%) grade-3 tumours. Amplification of the 18q21 region was detected in 10 of 40 (25%) cases, and trisomy 3 was detected in 9 of 34 (26%) cases. Amplification of the 18q21 region may be an important alternative pathogenetic pathway in MALT lymphoma and was found almost exclusively in tumours without 18q21 rearrangement. Our study showed that tumours with 18q21 rearrangement and 18q21 amplification develop along two distinct pathways, and the latter was more likely to transform into high-grade tumours upon acquisition of additional genetic alterations, such as trisomy 3. Trisomy 3 was more frequently found in coexistence with 18q21 abnormalities, suggesting that it was more likely to be a secondary aberration.
  9. Ng BW, Tan JA, Sabri S, Baharuddin A, Muhamad Ariffin MH
    Cureus, 2023 Mar;15(3):e36517.
    PMID: 37090402 DOI: 10.7759/cureus.36517
    Introduction Managing patients who present with symptoms of cervical myelopathy secondary to cervical ossification of the posterior longitudinal ligament (OPLL) is challenging. Various factors such as the number of levels involved with OPLL, types of OPLL, canal occupying ratio, K-line characteristics, and C2-C7 lordosis angle were found to guide decision-making and surgical approaches in managing this condition. However, no clear treatment algorithm has been published. This study aims to investigate the outcome of the management of cervical OPLL using a treatment algorithm used in a tertiary university hospital. Methods This is a retrospective cross-sectional study. Patients with cervical myelopathy secondary to cervical OPLL who were treated surgically in our center from 2014 to 2020 were included in this study. Demographic data and preoperative parameters that determined the treatment given according to our treatment algorithm were analyzed. Result A total of 24 patients fit the inclusion and exclusion criteria of the study. The mean recovery rate for all groups is 61.8[Formula: see text]21.9% and the mean postoperative neck disability index (NDI) is 17.83[Formula: see text]16.67%. There was a statistically significant difference between preoperative and postoperative Japanese Orthopaedic Association (JOA) scores for both anterior and posterior surgery subgroups. Conclusion We believe that the treatment algorithm used in our center could benefit other surgeons as a guide in managing patients who suffer from cervical myelopathy secondary to cervical OPLL. Further study including newer techniques would increase the surgeon's arsenal in providing the best outcome in managing this condition.
  10. Ng LH, Tan JA, Muhamad Ariffin MH
    Cureus, 2023 Aug;15(8):e43259.
    PMID: 37700956 DOI: 10.7759/cureus.43259
    Patients with myelomeningocele associated with severe kyphoscoliosis usually presented with rigid and angulated gibbus at their back. The condition causes this group of patients to face difficulties in their daily activities, especially in sitting and lying in supine positions. They are also prone to have a pressure sore over the gibbus and encounter the risk of infection. Here the authors would present a case of a four-year-old girl with underlying myelomeningocele who was diagnosed with worsening kyphoscoliosis along her growth. Her whole spine x-ray radiograph revealed a kyphosis angle of 80° between the T11 and L4 levels. The patient underwent a deformity corrective surgery with total kyphectomy in a combination of anterior and posterior spinal instrumentation. In the present case, we were able to obtain sufficient correction of the spinal kyphotic deformity in that patient in a single-stage surgery with satisfactory surgical outcomes at a four years follow-up.
  11. George E, Lai MI, Teh LK, Ramasamy R, Goh EH, Asokan K, et al.
    Med J Malaysia, 2011 Dec;66(5):429-34.
    PMID: 22390095 MyJurnal
    Detection and quantification of Hb subtypes of human blood is integral to presumptive identification of thalassaemias. It has been used in neonatal screening of thalassaemia and Hb variants. The use of discarded red blood cells following processing of the cord blood for stem cells provides readily available diagnostic material for thalassaemia screening. In this study, we determined the range of Hb subtypes in 195 consecutive cord blood samples collected for cord blood banking. The 'cord blood samples' analysed were those of the remaining red blood cells after the cord blood was processed for stem cell storage. Quantification of Hb subtypes by high performance liquid chromatography (HPLC) was done on BioRad Variant II Hb testing system. Only 73 (36.5%) of the samples could be analyzed neat without dilution. With a 1:300 dilution with wash solution the acceptable area as recommended by the manufacturer for reading of a C-gram within the 1 to 3 million ranges were achieved in all. Eighteen (9%) 12 showed classical Hb Barts (y4) prerun peaks were confirmed by Sebia Hydrasys automated Hb gel electrophoresis and quantified by Sebia Capillarys 2 capillary electrophoresis. Only 1 (0.5%) was presumptively identified with HbH disease. Due to the limited number of samples no beta-thalassaemia major, Hb E beta-thalassaemia and Hb Barts hydrops fetalis were found. The HPLC assay was possible at a cost US$ 5 per sample and a turnover time of 10 samples per hour without technical difficulties. This study reports an effective and valuable protocol for thalassaemia screening in red blood cells which would otherwise be discarded during cord blood processing. Cord blood with severe and intermediate forms of thalassaemia can be preselected and not stored.
  12. Wong FN, Tan JA, Keng TC, Ng KP, Chua KH, Kuppusamy UR
    Clin Chim Acta, 2016 Jan 30;453:56-61.
    PMID: 26657980 DOI: 10.1016/j.cca.2015.12.002
    BACKGROUND: This study aimed to investigate the relationship between soluble RAGE and estimated glomerular filtration rate (eGFR) in patients with chronic kidney disease (CKD) after controlling for the potential confounding factors such as medication usage and enzymatic antioxidants.
    METHODS: A total of 222 CKD patients whose eGFR is less than 60ml/min/1.73m(2) and 111 non-CKD individuals were recruited. The study subjects were classified based on their diabetes status. The plasma glutathione peroxidase (GPx) and superoxide dismutase (SOD) activities as well as plasma soluble RAGE level were measured.
    RESULTS: The plasma GPx and SOD activities were significantly lower and the plasma soluble RAGE level was significantly higher in the CKD patients than in the non-CKD individuals, regardless of the diabetes status. Soluble RAGE was significantly correlated with eGFR in both diabetic CKD (D-CKD) and non-diabetic CKD (ND-CKD) patients. The association between soluble RAGE and eGFR remained largely unaffected by the confounding factors in D-CKD patients. However, the confounding effect of enzymatic antioxidants in the relationship between eGFR and soluble RAGE was observed in ND-CKD patients.
    CONCLUSION: The increased plasma level of soluble RAGE is a better indicator of renal function decline in diabetic CKD patients instead of non-diabetic CKD patients.
    KEYWORDS: Chronic kidney disease; Diabetes; Enzymatic antioxidants; Glomerular filtration rate; Medications; Soluble RAGE
  13. Teh LK, George E, Lai MI, Tan JA, Wong L, Ismail P
    J Hum Genet, 2014 Mar;59(3):119-23.
    PMID: 24369358 DOI: 10.1038/jhg.2013.131
    Beta-thalassemia is one of the most prevalent inherited diseases and a public health problem in Malaysia. Malaysia is geographically divided into West and East Malaysia. In Sabah, a state in East Malaysia, there are over 1000 estimated cases of β-thalassemia major patients. Accurate population frequency data of the molecular basis of β-thalassemia major are needed for planning its control in the high-risk population of Sabah. Characterization of β-globin gene defects was done in 252 transfusion dependent β-thalassemia patients incorporating few PCR techniques. The study demonstrates that β-thalassemia mutations inherited are ethnically dependent. It is important to note that 86.9% of transfusion-dependent β-thalassemia major patients in Sabah were of the indigenous population and homozygous for a single mutation. The Filipino β(0)-deletion was a unique mutation found in the indigenous population of Sabah. Mutations common in West Malaysia were found in 11 (4.3%) patients. Four rare mutations (Hb Monroe, CD 8/9, CD 123/124/125 and IVS I-2) were also found. This study is informative on the population genetics of β-thalassemia major in Sabah.
  14. Tan JA, Chin SS, Ong GB, Mohamed Unni MN, Soosay AE, Gudum HR, et al.
    Public Health Genomics, 2015;18(1):60-4.
    PMID: 25412720 DOI: 10.1159/000368342
    BACKGROUND: Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak.
    METHODS: Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing.
    RESULTS: Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients.
    CONCLUSION: The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations.
  15. Teh LK, Lee TY, Tan JA, Lai MI, George E
    Int J Lab Hematol, 2015 Feb;37(1):79-89.
    PMID: 24725998 DOI: 10.1111/ijlh.12240
    In Malaysia, β-thalassaemia is a common inherited blood disorder in haemoglobin synthesis with a carrier rate of 4.5%. Currently, PCR-incorporating techniques such as amplification refractory mutation system (ARMS) or reverse dot blot hybridization (RDBH) are used in β-thalassaemia mutation detection. ARMS allows single-mutation identification using two reactions, one for wild type and another for mutant alleles. RDBH requires probe immobilization and optimization of hybridization and washing temperatures which is time consuming. The aim of our study was to investigate whether β-thalassaemia mutations can be identified in samples with low DNA concentrations.
  16. Chong YM, Tan JA, Zubaidah Z, Rahimah A, Kuldip K, George E
    Med J Malaysia, 2006 Jun;61(2):217-20.
    PMID: 16898315
    Thalassaemia is an inherited blood disorder and is a significant public health problem in Malaysia, with many not knowing they carry the gene for thalassaemia. The two major forms are alpha and beta thalassaemia. An individual can co-inherit both the alpha and beta thalassaemia genes. This study determined the frequency of concurrent carriers of alpha thalassaemia in 231 beta thalassaemia carriers. Gap-PCR was done on extracted DNA of the beta thalassaemia samples to check for alpha thalassaemia 1 molecular defect. Eight (3.5%) samples were found to have concurrently inherited the alpha thalassaemia 1 (- -SEA) deletion. The significant carrier rate for alpha thalassaemia 1 indicates the need for the implementation of DNA analysis to complement thalassaemia screening in high risk populations.
  17. Tan JA, Kho SL, Ngim CF, Chua KH, Goh AS, Yeoh SL, et al.
    Sci Rep, 2016 06 08;6:26994.
    PMID: 27271331 DOI: 10.1038/srep26994
    Haemoglobin (Hb) Adana (HBA2:c.179>A) interacts with deletional and nondeletional α-thalassaemia mutations to produce HbH disorders with varying clinical manifestations from asymptomatic to severe anaemia with significant hepatosplenomegaly. Hb Adana carriers are generally asymptomatic and haemoglobin subtyping is unable to detect this highly unstable α-haemoglobin variant. This study identified 13 patients with compound heterozygosity for Hb Adana with either the 3.7 kb gene deletion (-α(3.7)), Hb Constant Spring (HbCS) (HBA2:c.427T>C) or Hb Paksé (HBA2:429A>T). Multiplex Amplification Refractory Mutation System was used for the detection of five deletional and six nondeletional α-thalassaemia mutations. Duplex-PCR was used to confirm Hb Paksé and HbCS. Results showed 84.6% of the Hb Adana patients were Malays. Using DNA studies, compound heterozygosity for Hb Adana and HbCS (α(codon 59)α/α(CS)α) was confirmed in 11 patients. A novel point in this investigation was that DNA studies confirmed Hb Paksé for the first time in a Malaysian patient (α(codon 59)α/α(Paksé)α) after nine years of being misdiagnosis with Hb Adana and HbCS (α(codon 59)α/α(CS)α). Thus, the reliance on haematology studies and Hb subtyping to detect Hb variants is inadequate in countries where thalassaemia is prevalent and caused by a wide spectrum of mutations.
  18. Lee TY, Lai MI, Ismail P, Ramachandran V, Tan JA, Teh LK, et al.
    Genet. Mol. Res., 2016 Apr 07;15(2).
    PMID: 27173219 DOI: 10.4238/gmr.15027400
    Hemoglobin (Hb) Adana [HBA2: c179G>A (or HBA1); p.Gly60Asp] is a non-deletional α-thalassemia variant found in Malaysia. An improvement in the molecular techniques in recent years has made identification of Hb Adana much easier. For this study, a total of 26 Hb Adana α-thalassemia intermedia and 10 Hb Adana trait blood samples were collected from patients. Common deletional and non-deletional α-thalassemia genotypes were determined using multiplex gap polymerase chain reaction (PCR) and multiplex ARMS PCR techniques. Identification of the Hb Adana location on the α-globin gene was carried out using genomic sequencing and the location of the mutation was confirmed via restriction fragment length polymorphism-PCR. Among the 36 samples, 24 (66.7%) had the -α(3.7)/α(Cd59)α mutation, while the -α(3.7)/α(Cd59)α mutation accounted for 2 samples (5.6%) and the remaining 10 (27.8%) samples were α/α(Cd59)α. All 36 samples were found to have the Hb Adana mutation on the α2-globin gene. The position of the α-globin gene mutation found in our cases was similar to that reported in Indonesia (16%) but not to that in Turkey (0.6%). Our results showed that the Hb Adana mutation was preferentially present in the α2-globin genes in Malays compared to the other ethnicities in Malaysia. Thus, the Malays might have similar ancestry based on the similarities in the Hb Adana position.
  19. Chen JJ, Tan JA, Chua KH, Tan PC, George E
    BMJ Open, 2015 Jul 22;5(7):e007648.
    PMID: 26201722 DOI: 10.1136/bmjopen-2015-007648
    OBJECTIVES: Single nucleotide polymorphism (SNP) with a mutation can be used to identify the presence of the paternally-inherited wild-type or mutant allele as result of the inheritance of either allele in the fetus and allows the prediction of the fetal genotype. This study aims to identify paternal SNPs located at the flanking regions upstream or downstream from the β-globin gene mutations at CD41/42 (HBB:c.127_130delCTTT), IVS1-5 (HBB:c.92+5G>C) and IVS2-654 (HBB:c.316-197C>T) using free-circulating fetal DNA.

    SETTING: Haematology Lab, Department of Biomedical Science, University of Malaya.

    PARTICIPANTS: Eight couples characterised as β-thalassaemia carriers where both partners posed the same β-globin gene mutations at CD41/42, IVS1-5 and IVS2-654, were recruited in this study.

    OUTCOME MEASURES: Genotyping was performed by allele specific-PCR and the locations of SNPs were identified after sequencing alignment.

    RESULTS: Genotype analysis revealed that at least one paternal SNP was present for each of the couples. Amplification on free-circulating DNA revealed that the paternal mutant allele of SNP was present in three fcDNA. Thus, the fetuses may be β-thalassaemia carriers or β-thalassaemia major. Paternal wild-type alleles of SNP were present in the remaining five fcDNA samples, thus indicating that the fetal genotypes would not be homozygous mutants.

    CONCLUSIONS: This preliminary research demonstrates that paternal allele of SNP can be used as a non-invasive prenatal diagnosis approach for at-risk couples to determine the β-thalassaemia status of the fetus.

  20. Tan JA, Tan KL, Omar KZ, Chan LL, Wee YC, George E
    Eur J Pediatr, 2009 Sep;168(9):1049-54.
    PMID: 19034506 DOI: 10.1007/s00431-008-0877-9
    INTRODUCTION: Interactions of different hemoglobin variants with thalassemia alleles can result in various clinical phenotypes. HbE-beta-thalassemia generally manifests with severe anemia where individuals exhibit beta-thalassemia major with regular blood transfusions or beta-thalassemia intermedia with periodic blood transfusions. This study presents a unique Malay family with three beta-globin gene defects-HbE, Hb South Florida, and IVS1-1 (G-->A).

    MATERIALS AND METHODS: HbE activates a cryptic splice site that produces non-functional mRNAs. Hb South Florida is a rare beta-hemoglobin variant, and its interactions with other beta-thalassemia alleles have not been reported. IVS1-1 is a Mediterranean mutation that affects mRNA processing giving rise to beta(o)-thalassemia.

    RESULTS AND DISCUSSION: Fifteen mutations along the beta-globin gene complex were analyzed using the amplification refractory mutation system. Hb South Florida was identified by direct sequencing using genomic DNA.

    CONCLUSION: The affected child with HbE/IVS1-1 produced a beta-thalassemia major phenotype. Compound heterozygosity for Hb South Florida/IVS1-1 produced a beta-thalassemia carrier phenotype in the mother.

Filters
Contact Us

Please provide feedback to Administrator (afdal@afpm.org.my)

External Links