Displaying publications 3281 - 3300 of 5566 in total

Abstract:
Sort:
  1. Effects of supplementation with milk protein on glycemic parameters: a GRADE-assessed systematic review and dose-response meta-analysis
    Mohammadi S, Asbaghi O, Dolatshahi S, Omran HS, Amirani N, Koozehkanani FJ, et al.
    Nutr J, 2023 Oct 06;22(1):49.
    PMID: 37798798 DOI: 10.1186/s12937-023-00878-1
    BACKGROUND: It is suggested that supplementation with milk protein (MP) has the potential to ameliorate the glycemic profile; however, the exact impact and certainty of the findings have yet to be evaluated. This systematic review and dose-response meta-analysis of randomized controlled trials (RCTs) assessed the impact of MP supplementation on the glycemic parameters in adults.

    METHODS: A systematic search was carried out among online databases to determine eligible RCTs published up to November 2022. A random-effects model was performed for the meta-analysis.

    RESULTS: A total of 36 RCTs with 1851 participants were included in the pooled analysis. It was displayed that supplementation with MP effectively reduced levels of fasting blood glucose (FBG) (weighted mean difference (WMD): -1.83 mg/dL, 95% CI: -3.28, -0.38; P = 0.013), fasting insulin (WMD: -1.06 uU/mL, 95% CI: -1.76, -0.36; P = 0.003), and homeostasis model assessment of insulin resistance (HOMA-IR) (WMD: -0.27, 95% CI: -0.40, -0.14; P  8 weeks) with high or moderate doses (≥ 60 or 30-60 g/d) of MP or whey protein (WP). Serum FBG levels were considerably reduced upon short-term administration of a low daily dose of WP (

    Matched MeSH terms: Blood Glucose/metabolism
  2. Fulltext Dalbergiella welwitschia (Baker) Baker f. alkaloid-rich extracts attenuate liver damage in streptozotocin-induced diabetic rats
    Ajiboye BO, Dada S, Fatoba HO, Lawal OE, Oyeniran OH, Adetuyi OY, et al.
    Biomed Pharmacother, 2023 Dec;168:115681.
    PMID: 37837880 DOI: 10.1016/j.biopha.2023.115681
    This experiment was conducted to evaluate the Dalbergiella welwitschia alkaloid-rich extracts on liver damage in streptozotocin-induced diabetic rats. Hence, to induce diabetes, 45 mg/kg body weight of streptozotocin was intraperitoneally injected into the Wistar rats. Subsequently, 5 % (w/v) of glucose water was given to the induced animals for 24 h. Thus, the animals (48) were grouped into five groups (n = 8), containing normal control (NC), diabetic control (DC), diabetic rats placed on low (50 mg/kg body weight) and high (100 mg/kg body weight) doses of D. welwitschi alkaloid-rich leaf extracts (i.e. DWL and DWH respectively), and diabetic rats administered 200 mg/kg body weight of metformin (MET). The animals were sacrificed on the 21st day of the experiment, blood and liver were harvested, and different liver damage biomarkers were evaluated. The results obtained demonstrated that diabetic rats administered DWL, DWH and MET significantly (p  0.05) different when compared with NC. Also, diabetic rats administered DWL, DWH and MET revealed a significant (p  0.05) different when compared with NC. In addition, histological examination revealed that diabetic rats placed on DWL, DWH and MET normalized the hepatocytes. Consequently, it can be inferred that alkaloid-rich extracts from D. welwitschi leaf could be helpful in improving liver damage associated with diabetes mellitus rats.
    Matched MeSH terms: Blood Glucose/metabolism
  3. The Medicinal Mushroom Ganoderma neo-japonicum (Agaricomycetes) Polysaccharide Extract Prevents Obesity-Induced Diabetes in C57BL/6J Mice
    Subramaniam S, Ong KC, Sabaratnam V, Chua KH, Kuppusamy UR
    Int J Med Mushrooms, 2023;25(4):27-42.
    PMID: 37075082 DOI: 10.1615/IntJMedMushrooms.2023047595
    Ganoderma neo-japonicum Imazeki is a medicinal mushroom consumed by the indigenous people in Malaysia as a remedy for diabetes. This study aims to validate the efficacy of G. neo-japonicum polysaccharides (GNJP) on obesity-induced type 2 diabetes mellitus (T2DM) in C57BL/6J mice. Mice were divided into seven groups; normal diet (ND)-control, high-fat-diet (HFD)-control, HFDGNJP-treated (50, 100, 200 mg/kg b.w.), HFDMET (metformin 50 mg/kg; positive-control) and ND-GNJP (200 mg/kg b.w.). Mice were administered GNJP or metformin orally for 10 weeks (thrice/week) and sacrificed after an oral glucose tolerance test. Body weight, serum biochemicals, liver histology, adipocyte gene expressions, glucose and insulin levels were measured. HFD caused obesity, dyslipidemia, and diabetes in the untreated groups. GNJP (50 mg/kg b.w.) supplementation prevented weight gain and liver steatosis, improved serum lipid profile and glucose tolerance and attenuated hyperglycemia and hyperinsulinemia more effectively when compared with the other treatment groups. The prevention of obesity and lipid dysregulation is plausibly attributed to the increased hormone-sensitive lipase and reduced Akt-1 and Ppary gene expressions while the up-regulation of AdipoQ (adiponectin), Prkag2 and Slc2a4 genes served to sensitize insulin and improve glucose uptake. Thus, supplementation with an appropriate dose of GNJP has promising efficacies in preventing HFD aka obesity-induced T2DM and associated metabolic abnormalities.
    Matched MeSH terms: Blood Glucose/metabolism
  4. Fulltext Asia-Pacific consensus recommendations for application of continuous glucose monitoring in diabetes management
    Kong APS, Lim S, Yoo SH, Ji L, Chen L, Bao Y, et al.
    Diabetes Res Clin Pract, 2023 Jul;201:110718.
    PMID: 37196707 DOI: 10.1016/j.diabres.2023.110718
    Glucose monitoring has evolved from self-monitoring of blood glucose to glycated hemoglobin, and the latest continuous glucose monitoring (CGM). A key challenge to adoption of CGM for management of diabetes in Asia is the lack of regional CGM recommendations. Hence, thirteen diabetes-specialists from eight Asia-Pacific (APAC) countries/regions convened to formulate evidence-based, APAC-specific CGM recommendations for individuals with diabetes. We defined CGM metrics/targets and developed 13 guiding-statements on use of CGM in: (1) people with diabetes on intensive insulin therapy, and (2) people with type 2 diabetes on basal insulin with/without glucose lowering drugs. Continual use of CGM is recommended in individuals with diabetes on intensive insulin therapy and suboptimal glycemic control, or at high risk of problematic hypoglycemia. Continual/intermittent CGM may also be considered in individuals with type 2 diabetes on basal insulin regimen and with suboptimal glycemic control. In this paper, we provided guidance for optimizing CGM in special populations/situations, including elderly, pregnancy, Ramadan-fasting, newly diagnosed type 1 diabetes, and comorbid renal disease. Statements on remote CGM, and stepwise interpretation of CGM data were also developed. Two Delphi surveys were conducted to rate the agreement on statements. The current APAC-specific CGM recommendations provide useful guidance for optimizing use of CGM in the region.
    Matched MeSH terms: Blood Glucose; Blood Glucose Self-Monitoring
  5. Effects of R-salbutamol on the inflammatory response and acute lung injury in endotoxemic mice
    Beng H, Hu J, Wang S, Liang X, Qin H, Tan W
    Int Immunopharmacol, 2023 Aug;121:110482.
    PMID: 37364330 DOI: 10.1016/j.intimp.2023.110482
    Salbutamol, which consists of an R-isomer and S-isomer, is an effective and widely used β2 adrenoreceptor agonist that may possess anti-inflammatory properties in addition to its bronchodilator activity. Whether the salbutamol R-isomer has advantages over its racemic mixture and effectiveness in treating endotoxemia and endotoxin-induced lung injury has not been well studied. In this study, we investigated the preventive and therapeutic effects of R-salbutamol (R-sal), S-salbutamol (S-sal), and their racemic mixture (Rac-sal) on a mouse model of lipopolysaccharide (LPS)-induced endotoxemia. Dexamethasone (Dex) was used for comparison. The results showed that R-sal markedly improved the 7-day survival rate of endotoxic mice when administered before and after LPS treatment. Dex was toxic and accelerated the death of endotoxic mice when administered before LPS injection. Histological examination of the lungs revealed that the LPS challenge resulted in acute lung damage, including inflammatory cell infiltration, thickened alveolar septa, and congestion. R-sal pre-treatment effectively inhibited these changes, accompanied by markedly reduced lung myeloperoxidase levels, serum cytokine levels, and lactate release, significant restoration of lymphocyte count, and reduction of monocyte count. This may have occurred through inhibition of M1 macrophage inflammatory responses by enhancement of β-arrestin2 expression and suppression of NF-κB activation. Rac-sal exhibited diminished effects compared to that of R-sal, while S-sal showed enhanced release of some inflammatory cytokines. In addition, R-sal pre-treatment showed a better improvement in prognostic pulmonary function on day 4 compared to that by Rac-sal. Collectively, our results indicate the potential benefits of R-sal in regulating inflammatory responses to endotoxemia and endotoxin-induced lung injury.
    Matched MeSH terms: Lactic Acid/blood
  6. Fulltext Initiating or Switching to Insulin Degludec/Insulin Aspart in Adults with Type 2 Diabetes in Malaysia: Results from a Prospective, Non-interventional Real-World Study
    Mohamed M, Lim SC, Mumtaz M, Uppal S, Mukherjee D, Kassim MSM, et al.
    J ASEAN Fed Endocr Soc, 2023;38(1):37-44.
    PMID: 37252419 DOI: 10.15605/jafes.038.01.12
    OBJECTIVES: Insulin degludec (IDeg)/insulin aspart (IAsp; IDegAsp) is a co-formulation of 70% IDeg and 30% IAsp. According to several randomized controlled trials, IDegAsp is effective and safe for patients with type 2 diabetes mellitus (T2DM). A subgroup analysis of the ARISE study was conducted to explore the safety and efficacy of IDegAsp among Malaysian patients with T2DM in real-world settings.

    METHODOLOGY: ARISE, an open-label, multicenter, non-interventional, prospective study was conducted between August 2019 and December 2020. Adult Malaysian patients with T2DM who were enrolled from 14 sites received IDegAsp as per the local label for 26 weeks. The primary endpoint was change in glycated hemoglobin (HbA1c) levels from baseline to end of study (EOS).

    RESULTS: Of the 182 patients included in the full analysis set, 159 (87.4%) completed the study. From baseline to EOS, HbA1c (estimated difference [ED]: -1.3% [95% CI: -1.61 to -0.90]) and fasting plasma glucose levels (ED: -1.8 mmol/L [95% CI: -2.49 to -1.13]) were significantly reduced (p<0.0001). The patient-reported reduced hypoglycemic episodes (overall and nocturnal) during treatment. Overall, 37 adverse events were observed in 23 (12.6%) patients.

    CONCLUSION: Switching or initiating IDegAsp treatment resulted in significant improvements in glycemic control and a reduction in hypoglycemic episodes.

    Matched MeSH terms: Blood Glucose/analysis
  7. Fulltext Phenolics Extracted from Jasminum sambac Mitigates Diabetic Cardiomyopathy by Modulating Oxidative Stress, Apoptotic Mediators and the Nfr-2/HO-1 Pathway in Alloxan-Induced Diabetic Rats
    Umar U, Ahmed S, Iftikhar A, Iftikhar M, Majeed W, Liaqat A, et al.
    Molecules, 2023 Jul 17;28(14).
    PMID: 37513325 DOI: 10.3390/molecules28145453
    Diabetes mellitus is a chronic metabolic disorder defined as hyperglycemia and pancreatic β-cell deterioration, leading to other complications such as cardiomyopathy. The current study assessed the therapeutic effects of phenolic acids extracted from Jasminum sambac phenols of leaves (JSP) against diabetes-induced cardiomyopathy in rats. The rats were divided into four groups, with each group consisting of 20 rats. The rats were given intraperitoneal injections of alloxan monohydrate (150 mg/kg) to induce diabetes. The diabetes-induced groups (III and IV) received treatment for six weeks that included 250 and 500 mg/kg of JSP extract, respectively. In the treated rats, the results demonstrated that JSP extract restored fasting glucose, serum glucose, and hyperlipidemia. Alloxan induced cardiomyopathy, promoted oxidative stress, and altered cardiac function biomarkers, including cardiac troponin I, proBNP, CK-MB, LDH, and IMA. The JSP extract-treated rats showed improved cardiac function indicators, apoptosis, and oxidative stress. In diabetic rats, the mRNA expression of caspase-3, BAX, and Bcl-2 was significantly higher, while Bcl-2, Nrf-2, and HO-,1 was significantly lower. In the treated groups, the expression levels of the BAX, Nrf-2, HO-1, Caspase-3, and Bcl-2 genes were dramatically returned to normal level. According to our findings, the JSP extract prevented cardiomyopathy and heart failure in the hyperglycemic rats by improving cardiac biomarkers and lowering the levels of hyperlipidemia, oxidative stress, apoptosis, hyperglycemia, and hyperlipidemia.
    Matched MeSH terms: Blood Glucose/metabolism
  8. Electrochemical detection of ractopamine at arrays of micro-liquid | liquid interfaces
    Sairi M, Arrigan DW
    Talanta, 2015 Jan;132:205-14.
    PMID: 25476299 DOI: 10.1016/j.talanta.2014.08.060
    The behaviour of protonated ractopamine (RacH(+)) at an array of micro-interfaces between two immiscible electrolyte solutions (micro-ITIES) was investigated via cyclic voltammetry (CV) and linear sweep stripping voltammetry (LSSV). The micro-ITIES array was formed at silicon membranes containing 30 pores of radius 11.09±0.12 µm and pore centre-to-centre separation of 18.4±2.1 times the pore radius. CV shows that RacH(+) transferred across the water |1,6-dichlorohexane µITIES array at a very positive applied potential, close to the upper limit of the potential window. Nevertheless, CV was used in the estimation of some of the drug's thermodynamic parameters, such as the formal transfer potential and the Gibbs transfer energy. LSSV was implemented by pre-concentration of the drug, into the organic phase, followed by voltammetric detection, based on the back-transfer of RacH(+) from the organic to aqueous phase. Under optimised pre-concentration and detection conditions, a limit of detection of 0.1 µM was achieved. In addition, the impact of substances such as sugar, ascorbic acid, metal ions, amino acid and urea on RacH(+) detection was assessed. The detection of RacH(+) in artificial serum indicated that the presence of serum protein interferes in the detection signal, so that sample deproteinisation is required for feasible bioanalytical applications.
    Matched MeSH terms: Blood Proteins/chemistry
  9. Fulltext Circulating pancreatic polypeptide concentrations predict visceral and liver fat content
    Sam AH, Sleeth ML, Thomas EL, Ismail NA, Mat Daud N, Chambers E, et al.
    J Clin Endocrinol Metab, 2015 Mar;100(3):1048-52.
    PMID: 25490276 DOI: 10.1210/jc.2014-3450
    CONTEXT AND OBJECTIVE: No current biomarker can reliably predict visceral and liver fat content, both of which are risk factors for cardiovascular disease. Vagal tone has been suggested to influence regional fat deposition. Pancreatic polypeptide (PP) is secreted from the endocrine pancreas under vagal control. We investigated the utility of PP in predicting visceral and liver fat.

    PATIENTS AND METHODS: Fasting plasma PP concentrations were measured in 104 overweight and obese subjects (46 men and 58 women). In the same subjects, total and regional adipose tissue, including total visceral adipose tissue (VAT) and total subcutaneous adipose tissue (TSAT), were measured using whole-body magnetic resonance imaging. Intrahepatocellular lipid content (IHCL) was quantified by proton magnetic resonance spectroscopy.

    RESULTS: Fasting plasma PP concentrations positively and significantly correlated with both VAT (r = 0.57, P < .001) and IHCL (r = 0.51, P < .001), but not with TSAT (r = 0.02, P = .88). Fasting PP concentrations independently predicted VAT after controlling for age and sex. Fasting PP concentrations independently predicted IHCL after controlling for age, sex, body mass index (BMI), waist-to-hip ratio, homeostatic model assessment 2-insulin resistance, (HOMA2-IR) and serum concentrations of triglyceride (TG), total cholesterol (TC), and alanine aminotransferase (ALT). Fasting PP concentrations were associated with serum ALT, TG, TC, low- and high-density lipoprotein cholesterol, and blood pressure (P < .05). These associations were mediated by IHCL and/or VAT. Fasting PP and HOMA2-IR were independently significantly associated with hepatic steatosis (P < .01).

    CONCLUSIONS: Pancreatic polypeptide is a novel predictor of visceral and liver fat content, and thus a potential biomarker for cardiovascular risk stratification and targeted treatment of patients with ectopic fat deposition.

    Matched MeSH terms: Pancreatic Polypeptide/blood*
  10. Current aspects in hemoglobin A1c detection: a review
    Ang SH, Thevarajah M, Alias Y, Khor SM
    Clin Chim Acta, 2015 Jan 15;439:202-11.
    PMID: 25451954 DOI: 10.1016/j.cca.2014.10.019
    Type 2 diabetes mellitus (T2DM) is a pressing health issue that threatens global health and the productivity of populations worldwide. Despite its long-recognized role in diabetes management, glycated hemoglobin (HbA1c) only received WHO endorsement as a T2DM diagnostic tool in 2011. Although conventional plasma-specific tests have long been utilized to diagnose T2DM, the public should be informed that plasma-specific tests are not markedly better than HbA1c tests, particularly in terms of variability and convenience for diagnosing diabetes. In the midst of the debates associated with establishing HbA1c as the preeminent diabetes diagnostic tool, unceasing efforts to standardize HbA1c tests have played an integral part in achieving more efficient communication from laboratory to clinical practice and thus better diabetes care. This review discusses the current status of HbA1c tests in the diagnosis, prevention, treatment and management of T2DM across the globe, focusing on increasing the recognition of glycated hemoglobin variants with effective utilization of different HbA1c methods, updating the current status of HbA1c standardization programs, tapping into the potential of POC analyzers to establish a cost-effective HbA1c test for diabetes care, and inspiring the advancement of HbA1c biosensors for future clinical usage.
    Matched MeSH terms: Diabetes Mellitus, Type 2/blood*
  11. Fulltext Dietary conjugated linoleic acid alters oxidative stability and alleviates plasma cholesterol content in meat of broiler chickens
    Kumari Ramiah S, Meng GY, Ebrahimi M
    ScientificWorldJournal, 2014;2014:949324.
    PMID: 25386625 DOI: 10.1155/2014/949324
    This study was conducted to investigate the effects of dietary conjugated linoleic acid (CLA) on fatty acid composition, lipoprotein content, lipid peroxidation, and meat colour of broiler chickens. A total of 180 broiler chickens were allocated to 3 dietary treatments (0, 2.5, and 5% Lutrell) and given a standard broiler starter diet and finisher diet. Body weight of chickens and feed intake were recorded weekly. After slaughter, the breast meat was aged at 4 °C for 0, 3, and 6 days. The fatty acid composition was measured in the breast meat. Body weight (BW) and feed efficiency were decreased by dietary CLA level (P < 0.05). Chicken fed with 2.5% Lutrell had the highest feed intake compared to the control (CON) group. The total CLA increased significantly (P < 0.05) in breast meat from birds supplemented with CLA. Propensity for lipid peroxidation was significantly higher after 6 days of meat storage (P < 0.05) and the redness in chicken breast meat was lower in CLA-fed birds (P < 0.05). It is also notable that a 5% Lutrell supplementation decreased the plasma total cholesterol (TC), low density protein (LDL), and HDL (high-density lipoprotein)/LDL ratio in chickens (P < 0.05).
    Matched MeSH terms: Cholesterol/blood
  12. Fulltext Severe Plasmodium falciparum infection mimicking acute myocardial infarction
    Sulaiman H, Ismail MD, Jalalonmuhali M, Atiya N, Ponnampalavanar S
    Malar J, 2014;13:341.
    PMID: 25176417 DOI: 10.1186/1475-2875-13-341
    This case report describes a case of presumed acute myocardial infarction in a returned traveler who was later diagnosed to have severe malaria. Emergency coronary angiography was normal and subsequent peripheral blood film was positive for Plasmodium falciparum.
    Matched MeSH terms: Blood/parasitology
  13. Fulltext Anaphylactic shock following the bite of a wild Kayan slow loris (Nycticebus kayan): implications for slow loris conservation
    Madani G, Nekaris KA
    J Venom Anim Toxins Incl Trop Dis, 2014;20(1):43.
    PMID: 25309586 DOI: 10.1186/1678-9199-20-43
    BACKGROUND: Asian slow lorises (Nycticebus spp.) are one of few known venomous mammals, yet until now only one published case report has documented the impact of their venomous bite on humans. We describe the reaction of a patient to the bite of a subadult Nycticebus kayan, which occurred in the Mulu District of Sarawak in 2012.

    FINDINGS: Within minutes of the bite, the patient experienced paraesthesia in the right side of the jaw, ear and right foot. By 40 minutes, swelling of the face was pronounced. The patient was admitted to Mulu National Park Health Clinic/Klinik Kesihatan Taman Mulu Tarikh, at which time he was experiencing: swollen mouth, chest pain, mild abdominal pain, nausea, numbness of the lips and mouth, shortness of breath, weakness, agitation and the sensation of pressure in the ears due to swelling. The blood pressure was 110/76, the heart ratio was 116 and oxygen saturation was 96%. The patient was treated intramuscularly with adrenaline (0.5 mL), followed by intravenous injection of hydrocortisone (400 mg) and then intravenous fluid therapy of normal saline (500 mg). By 8 h10 the next day, the patient's condition had significantly improved with no nausea, and with blood pressure and pulse rate stable.

    CONCLUSIONS: A handful of anecdotes further support the real danger that slow loris bites pose to humans. As the illegal pet trade is a major factor in the decline of these threatened species, we hope that by reporting on the danger of handling these animals it may help to reduce their desirability as a pet.
    Matched MeSH terms: Blood Pressure; Blood Pressure Determination
  14. Variability and repeatability of quantitative, Fourier-domain optical coherence tomography Doppler blood flow in young and elderly healthy subjects
    Tayyari F, Yusof F, Vymyslicky M, Tan O, Huang D, Flanagan JG, et al.
    Invest Ophthalmol Vis Sci, 2014 Dec;55(12):7716-25.
    PMID: 25335983 DOI: 10.1167/iovs.14-14430
    The purpose of this study was to determine the within-session variability and between-session repeatability of spectral Fourier-domain optical coherence tomography (Doppler FD-OCT) Doppler retinal blood flow measurements in young and elderly subjects.
    Matched MeSH terms: Regional Blood Flow/physiology
  15. Fulltext Numerical investigation of the effect of stenosis geometry on the coronary diagnostic parameters
    Kamangar S, Kalimuthu G, Badruddin IA, Badarudin A, Ahmed NJ, Khan TM
    ScientificWorldJournal, 2014;2014:354946.
    PMID: 25258722 DOI: 10.1155/2014/354946
    The present study deals with the functional severity of a coronary artery stenosis assessed by the fractional flow reserve (FFR). The effects of different geometrical shapes of lesion on the diagnostic parameters are unknown. In this study, 3D computational simulation of blood flow in three different geometrical shapes of stenosis (triangular, elliptical, and trapezium) is considered in steady and transient conditions for 70% (moderate), 80% (intermediate), and 90% (severe) area stenosis (AS). For a given percentage AS, the variation of diagnostic parameters which are derived from pressure drop across the stenosis was found in three different geometrical shapes of stenosis and it was observed that FFR is higher in triangular shape and lower in trapezium shape. The pressure drop coefficient (CDP) was higher in trapezium shape and lower in triangular model whereas the LFC shows opposite trend. From the clinical perspective, the relationship between percentage AS and FFR is linear and inversely related in all the three models. A cut-off value of 0.75 for FFR was observed at 76.5% AS in trapezium model, 79.5% in elliptical model, and 82.7% AS for the triangular shaped model. The misinterpretation of the functional severity of the stenosis is in the region of 76.5%-82.7 % AS from different shapes of stenosis models.
    Matched MeSH terms: Blood Flow Velocity; Blood Pressure
  16. Fulltext A case-control study of risk factors for bovine brucellosis seropositivity in Peninsular Malaysia
    Anka MS, Hassan L, Khairani-Bejo S, Zainal MA, Mohamad RB, Salleh A, et al.
    PLoS One, 2014;9(9):e108673.
    PMID: 25265020 DOI: 10.1371/journal.pone.0108673
    Bovine brucellosis was first reported in Peninsular Malaysia in 1950. A subsequent survey conducted in the country revealed that the disease was widespread. Current knowledge on the potential risk factors for brucellosis occurrence on cattle farms in Malaysia is lacking. Therefore, we conducted a case-control study to identify the potential herd-level risk factors for bovine brucellosis occurrence in four states in the country, namely Kelantan, Pahang, Selangor and Negeri Sembilan. Thirty-five cases and 36 controls of herds were selected where data on farm management, biosecurity, medical history and public health were collected. Multivariable logistic regression identified that Brucella seropositive herds were more likely to; have some interaction with wildlife (OR 8.9, 95% CI = 1.59-50.05); originated from farms where multiple species such as buffalo/others (OR 41.8, 95% CI = 3.94-443.19) and goat/sheep (OR 8.9, 95%Cl = 1.10-71.83) were reared, practice extensive production system (OR 13.6, 95% CI 1.31-140.24) and have had episodes of abortion in the past (OR 51.8, 95% CI = 4.54-590.90) when compared to seronegative herds. Considering the lack of information on the epidemiology of bovine brucellosis in peninsular Malaysia and absence of information on preventing the inception or spread of the disease, this report could contribute to the on-going area-wise national brucellosis eradication program.
    Matched MeSH terms: Brucellosis, Bovine/blood
  17. Fulltext In vitro porcine blood-brain barrier model for permeability studies: pCEL-X software pKa(FLUX) method for aqueous boundary layer correction and detailed data analysis
    Yusof SR, Avdeef A, Abbott NJ
    Eur J Pharm Sci, 2014 Dec 18;65:98-111.
    PMID: 25239510 DOI: 10.1016/j.ejps.2014.09.009
    In vitro blood-brain barrier (BBB) models from primary brain endothelial cells can closely resemble the in vivo BBB, offering valuable models to assay BBB functions and to screen potential central nervous system drugs. We have recently developed an in vitro BBB model using primary porcine brain endothelial cells. The model shows expression of tight junction proteins and high transendothelial electrical resistance, evidence for a restrictive paracellular pathway. Validation studies using small drug-like compounds demonstrated functional uptake and efflux transporters, showing the suitability of the model to assay drug permeability. However, one limitation of in vitro model permeability measurement is the presence of the aqueous boundary layer (ABL) resulting from inefficient stirring during the permeability assay. The ABL can be a rate-limiting step in permeation, particularly for lipophilic compounds, causing underestimation of the permeability. If the ABL effect is ignored, the permeability measured in vitro will not reflect the permeability in vivo. To address the issue, we explored the combination of in vitro permeability measurement using our porcine model with the pKa(FLUX) method in pCEL-X software to correct for the ABL effect and allow a detailed analysis of in vitro (transendothelial) permeability data, Papp. Published Papp using porcine models generated by our group and other groups are also analyzed. From the Papp, intrinsic transcellular permeability (P0) is derived by simultaneous refinement using a weighted nonlinear regression, taking into account permeability through the ABL, paracellular permeability and filter restrictions on permeation. The in vitro P0 derived for 22 compounds (35 measurements) showed good correlation with P0 derived from in situ brain perfusion data (r(2)=0.61). The analysis also gave evidence for carrier-mediated uptake of naloxone, propranolol and vinblastine. The combination of the in vitro porcine model and the software analysis provides a useful tool to better predict BBB permeability in vivo and gain better mechanistic information about BBB permeation.
    Matched MeSH terms: Blood-Brain Barrier/metabolism*
  18. Fulltext Imaging of skin birefringence for human scar assessment using polarization-sensitive optical coherence tomography aided by vascular masking
    Gong P, Chin L, Es'haghian S, Liew YM, Wood FM, Sampson DD, et al.
    J Biomed Opt, 2014 Dec;19(12):126014.
    PMID: 25539060 DOI: 10.1117/1.JBO.19.12.126014
    We demonstrate the in vivo assessment of human scars by parametric imaging of birefringence using polarization-sensitive optical coherence tomography (PS-OCT). Such in vivo assessment is subject to artifacts in the detected birefringence caused by scattering from blood vessels. To reduce these artifacts, we preprocessed the PS-OCT data using a vascular masking technique. The birefringence of the remaining tissue regions was then automatically quantified. Results from the scars and contralateral or adjacent normal skin of 13 patients show a correspondence of birefringence with scar type: the ratio of birefringence of hypertrophic scars to corresponding normal skin is 2.2 ± 0.2 (mean ± standard deviation ), while the ratio of birefringence of normotrophic scars to normal skin is 1.1 ± 0.4 . This method represents a new clinically applicable means for objective, quantitative human scar assessment.
    Matched MeSH terms: Skin/blood supply
  19. Inflammation and L-carnitine therapy in hemodialysis patients: a review
    Khalatbari-Soltani S, Tabibi H
    Clin Exp Nephrol, 2015 Jun;19(3):331-5.
    PMID: 25446285 DOI: 10.1007/s10157-014-1061-3
    Inflammation is a common complication in hemodialysis (HD) patients with no valid treatment strategy. In addition, carnitine deficiency occurs frequently in HD patients because of intradialytic loss of carnitine, impaired de novo carnitine renal synthesis, and reduced dietary intake. It appears that carnitine deficiency is related to inflammation in HD patients. A few clinical trials have investigated the effect of L-carnitine supplement on inflammatory markers in HD patients. All studies in this field, except one, showed that L-carnitine could significantly reduce C-reactive protein and serum amyloid A, as two systemic inflammation markers, in HD patients. Therefore, considering high prevalence of inflammation and carnitine deficiency in HD patients, L-carnitine therapy is a reasonable approach for reducing systemic inflammation and its complications in these patients.
    Matched MeSH terms: Inflammation/blood
  20. Transfusion-dependent thalassemia in Northern Sarawak: a molecular study to identify different genotypes in the multi-ethnic groups and the importance of genomic sequencing in unstudied populations
    Tan JA, Chin SS, Ong GB, Mohamed Unni MN, Soosay AE, Gudum HR, et al.
    Public Health Genomics, 2015;18(1):60-4.
    PMID: 25412720 DOI: 10.1159/000368342
    BACKGROUND: Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak.
    METHODS: Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing.
    RESULTS: Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients.
    CONCLUSION: The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations.
    Matched MeSH terms: Blood Transfusion/methods*
Related Terms
Filters
Contact Us

Please provide feedback to Administrator (afdal@afpm.org.my)

External Links