Displaying publications 41 - 60 of 166 in total

Abstract:
Sort:
  1. Occurrence and risk assessment of glycidyl and 3-monochloropropanediol esters in infant formulas marketed in Taiwan
    Liu C, Wang ST, Tan CH, Lin ZE, Lee WJ
    Food Addit Contam Part A Chem Anal Control Expo Risk Assess, 2024 Apr;41(4):352-364.
    PMID: 38422382 DOI: 10.1080/19440049.2024.2319271
    Glycidyl esters (GEs) and 3-monochloropropanediol esters (3-MCPDEs) are process contaminants commonly found in refined edible oils which are often added to infant formulas. The Taiwan Food and Drug Administration (TFDA) launched regulations for GEs in infant formulas that went into effect on 1 July 2021. To investigate levels of GEs and 3-MCPDEs in infant formula powder, 45 products were sampled and analysed during 2020-2021. The contents of GEs and 3-MCPDEs in formulas of different brands significantly varied, but their concentrations in all of the formulas complied with European Union (EU) regulations. Infant formulas containing palm oil had significantly higher 3-MCPDE levels in both extracted oils and milk powder than those without palm oil. Concentrations of GEs and 3-MCPDEs in infant formula powder and extracted oils were significantly lower in products from Europe than those from Australia and New Zealand. Infants aged 0-1 years in Taiwan who consumed only infant formula showed a margin of exposure (MoE) exceeding 25,000. Mean consumer exposures to 3-MCPDEs stayed below the tolerable daily intake (TDI), while high exposures at the 95th percentile (P95) exceeded the TDI by 1.7-fold. Herein, we present the changing trends in the risk assessment results of infant formula across various countries in the decade. Implementation of regulations and mitigation strategy effectively reduced the risk of infants being exposed to GEs and 3-MCPDEs through infant formula.
    Matched MeSH terms: Food Contamination/analysis
  2. Toxicity assessment of heavy metals translocation in maize grown in the Ganges delta floodplain soils around the Payra power plant in Bangladesh
    Islam MS, Al Bakky A, Ahmed S, Islam MT, Antu UB, Saikat MSM, et al.
    Food Chem Toxicol, 2024 Nov;193:115005.
    PMID: 39284411 DOI: 10.1016/j.fct.2024.115005
    As a cereal crop, maize ranked third place after wheat and rice in terms of land area coverage for its cultivation, and in Bangladesh, it ranked second place after rice in its production. As the substitution of wheat products, maize has been used widely in baking for human consumption and animal fodder. However, maize grown in this soil around the coal-burning power plant may cause heavy metals uptake that poses a risk to humans. The study was conducted at the maize fields in the Ganges delta floodplain soils of Bangladesh to know the concentration of eight heavy metals (Ni, Cr, Cd, Mn, As, Cu, Zn, and Pb) in soil and maize samples using an inductively coupled plasma mass spectrometer (ICP-MS) and to estimate the risk of heavy metals in maize grains. Mean concentrations of heavy metals (mg/kg) in soil were in decreasing order of Zn (10.12) > Cu (10.02) > Mn (5.48) > Ni (4.95) > Cr (3.72) > As (0.51) > Pb (0.27) > Cd (0.23). The plant tissues showed the descending order of heavy metal concentration as roots > grains > stems > leaves. BCF values for As, Cd, Pb, and Mn in roots were higher than 1.0, indicating considerable accumulation of these elements in maize via roots. Total hazard quotient (ƩTHQ) of heavy metals through maize grain consumption was 3.7E+00 and 3.9E+00 for adults and children, respectively, indicating non-cancer risk to the consumers. Anthropogenic influences contributed to the heavy metals enrichment in the Ganges delta floodplain soils around the thermal plant, and potential risks (non-carcinogenic and carcinogenic) were observed due to the consumption of maize grain cultivated in the study area.
    Matched MeSH terms: Food Contamination/analysis
  3. Development of real-time polymerase chain reaction for analysis of rat meat (Bandicota bengalensis) in beef meatballs for halal authentication
    Rohman A, Nawwaruddin HH, Hossain MAM, Laksitorini MD, Lestari D
    Open Vet J, 2024 Sep;14(9):2484-2492.
    PMID: 39553767 DOI: 10.5455/OVJ.2024.v14.i9.37
    BACKGROUND: Consumer awareness of food adulteration is increasing nowadays. Motivated by economic gain, unethical meat producers try to blend halal meat such as beef with non-halal meat like rat meat (RM).

    AIM: This study aims to develop a real-time polymerase chain reaction (RT-PCR) analysis method to analyze the presence of RM in beef meatballs.

    METHODS: This research was carried out in the following stages: primer design, DNA isolation, analysis of DNA isolates, the optimization of primer annealing temperature, primer specificity test, sensitivity, and repeatability. The validated RT-PCR method was then used to analyze the marketed meatball samples.

    RESULTS: The result showed that the designed primer targeting on ND2 gene set rat mt-DNA (forward: ACTCCATATCTCTCACCATATTTCC; reverse: GGGTTAGGGTACTTAGGATTGTTAG), had good specificity at an optimal annealing temperature of 56.3oC over the other eight species. The developed RT-PCR method produces a limit detection value of 195.31 pg, coefficient of determination (R 2) for linearity of 0.983, amplification efficiency (E) of 100%, and CV value for amplification response of 1.8%. The result showed that the developed RT-PCR method did not detect the presence of RM DNA in eight marketed beef meatball samples.

    CONCLUSION: The developed method meets the acceptance criteria for RT-PCR and can be used as a halal authentication method to identify the presence of RM in beef meatballs.

    Matched MeSH terms: Food Contamination/analysis
  4. Quality and safety of buffalo milk from Malaysian farms: physicochemical properties, aflatoxin M1 and antibiotic residues
    Ibrahim AS, Sukor R, Meor Hussin AS, Mohsin AZ
    J Dairy Res, 2025 Nov;92(4):650-653.
    PMID: 41560378 DOI: 10.1017/S0022029925101660
    This Research Communication reports the physicochemical properties, aflatoxin levels and antibiotic residues in buffalo milk. The milk and feed samples were collected from nine farms in Peninsular Malaysia, with the lactation stage studied in one farm. Buffalo milk composition varied across farms; Petaling Jaya showed high fat and total solids but low protein and solids non-fat (SNF), while Jitra 1 and Seberang Perai 2 exhibited higher protein, casein and SNF. Langkawi and Hulu Langat had higher moisture, ash and lactose levels. Early and late lactation were linked to higher protein and casein. Aflatoxin B1 in feed was undetectable; however, aflatoxin M1, amoxicillin and oxytetracycline were present in milk but below the regulatory limits. These findings indicate that current on-farm management practices are effective in ensuring the safety and quality of buffalo milk, while continuous monitoring remains crucial.
    Matched MeSH terms: Food Contamination/analysis
  5. Human health risk assessment due to consumption of dried fish in Chennai, Tamil Nadu, India: a baseline report
    Priyadharshini M, Ahmed MS, Pradhoshini KP, Santhanabharathi B, Ahmed MFS, Alam L, et al.
    Environ Sci Pollut Res Int, 2024 Jun;31(29):41388-41401.
    PMID: 37171725 DOI: 10.1007/s11356-023-27339-w
    The current study sought to determine the levels of radioactivity and heavy metal contamination in 22 dried fish samples collected in Chennai, Tamil Nadu. The study found that there were substantial heavy metals concentrations for Pb, Mn, Cr, Co, and Cd. The concentration of heavy metal Pb being alarmingly high (32.85 to 42.09 mg/kg), followed by Cd (2.18 mg/kg to 3.51 mg/kg) than the permissible limit of WHO (2.17 mg/kg) for Pb and (0.05 mg/kg) for Cd. In terms of radioactivity, the gross alpha activity in the dried fish samples ranged 6.25 ± 0.12 to 48.21 ± 0.11 Bg/kg with an average of 20.35 Bg/kg and with a gross beta activity from 6.48 ± 0.02 to 479.47 ± 0.65 Bg/kg, for an average of 136.83 Bg/kg. The study found that the internal radiation dose that people receive upon consuming the fish species Sphyraena obtusata, Rachycentron canadum, Lepidocephalichthys thermalis, Synodontidae, Carangoides malabaricus, Sardina pilchardus, Scomberomorus commerson, Sillago sihama, Gerres subfasciatus, and Amblypharyngodon mola is above the ICRP-recommended limit of less than 1 mSv/year. Annual gonadal dose equivalent (AGDE) and total excessive lifetime cancer risk (ELCR) ranged 0.488 µSv year-1 and 0.004 µSv year-1 respectively, the values of AGDE being higher than the global average value. The findings of the study indicate that the analyzed dried fish samples are contaminated with Pb and Cd, which shall pose cancer risk to the consumers as a result.
    Matched MeSH terms: Food Contamination/analysis
  6. Advances in organic-inorganic hybrid sorbents for the extraction of organic and inorganic pollutants in different types of food and environmental samples
    Ng NT, Kamaruddin AF, Wan Ibrahim WA, Sanagi MM, Abdul Keyon AS
    J Sep Sci, 2018 Jan;41(1):195-208.
    PMID: 28834218 DOI: 10.1002/jssc.201700689
    The efficiency of the extraction and removal of pollutants from food and the environment has been an important issue in analytical science. By incorporating inorganic species into an organic matrix, a new material known as an organic-inorganic hybrid material is formed. As it possesses high selectivity, permeability, and mechanical and chemical stabilities, organic-inorganic hybrid materials constitute an emerging research field and have become popular to serve as sorbents in various separaton science methods. Here, we review recent significant advances in analytical solid-phase extraction employing organic-inorganic composite/nanocomposite sorbents for the extraction of organic and inorganic pollutants from various types of food and environmental matrices. The physicochemical characteristics, extraction properties, and analytical performances of sorbents are discussed; including morphology and surface characteristics, types of functional groups, interaction mechanism, selectivity and sensitivity, accuracy, and regeneration abilities. Organic-inorganic hybrid sorbents combined with extraction techniques are highly promising for sample preparation of various food and environmental matrixes with analytes at trace levels.
    Matched MeSH terms: Food Contamination/analysis*
  7. Case Report: Paralytic Shellfish Poisoning in Sabah, Malaysia
    Suleiman M, Jelip J, Rundi C, Chua TH
    Am J Trop Med Hyg, 2017 Dec;97(6):1731-1736.
    PMID: 29016314 DOI: 10.4269/ajtmh.17-0589
    During the months of January-February and May-June 2013 coinciding with the red tide occurrence in Kota Kinabalu, Sabah, Malaysia, six episodes involving 58 cases of paralytic shellfish poisoning (PSP) or saxitoxin (STX) poisoning and resulting in four deaths were reported. Many of them were intoxicated from consuming shellfish purchased from the markets, whereas others were intoxicated from eating shellfish collected from the beach. Levels of STX in shellfish collected from the affected areas were high (mean 2,920 ± 780 and 360 ± 140 µg STX equivalents/100 g shellfish meat respectively for the two periods). The count of toxic dinoflagellates (Pyrodinium bahamense var compressum) of the sea water sampled around the coast was also high (mean 34,200 ± 10,300 cells/L). Species of shellfish containing high levels of STX were Atrina fragilis, Perna viridis, and Crassostrea belcheri. The age of victims varied from 9 to 67 years. Symptoms presented were typical of PSP, such as dizziness, numbness, vomiting, and difficulty in breathing. Recommended steps to prevent or reduce PSP in future red tide season include better monitoring of red tide occurrence, regular sampling of shellfish for determination of STX level, wider dissemination of information on the danger of eating contaminated shellfish among the communities, fishermen, and fishmongers.
    Matched MeSH terms: Food Contamination/analysis
  8. Effect of food preparation using naturally-contaminated groundwater from La Pampa, Argentina: Estimation of elemental dietary intake from rice and drinking water
    Jaafar M, Marcilla AL, Felipe-Sotelo M, Ward NI
    Food Chem, 2018 Apr 25;246:258-265.
    PMID: 29291847 DOI: 10.1016/j.foodchem.2017.11.019
    Water from La Pampa, Argentina, was used for washing and cooking rice to examine the in-situ impact of using naturally-contaminated water for food preparation on the elemental dietary intake. Whilst washing with the control tap water (28 μg/L As) reduced the concentration of As in rice by 23%, the use of different well waters (281-1144 μg/L) increased As levels significantly (48-227%) in comparison with the original concentration in the rice (0.056 µg/g). Cooking the rice at a low water-to-rice ratio (2:1) using modern methods increased the levels of As in the cooked samples by 2-3 orders of magnitude for both pre-washed and un-washed rice. Similar trends were observed for vanadium. Although the levels of manganese, iron, copper, zinc and molybdenum in rice were reduced during washing and cooking for most water samples, the molybdenum concentration in the cooked rice doubled (2.2-2.9 µg/g) when using water containing >1 mg/L Mo.
    Matched MeSH terms: Food Contamination/analysis*
  9. Simultaneous formation of polycyclic aromatic hydrocarbons (PAHs) and heterocyclic aromatic amines (HCAs) in gas-grilled beef satay at different temperatures
    Ahmad Kamal NH, Selamat J, Sanny M
    Food Addit Contam Part A Chem Anal Control Expo Risk Assess, 2018 May;35(5):848-869.
    PMID: 29334335 DOI: 10.1080/19440049.2018.1425553
    This study investigated the simultaneous formation of polycyclic aromatic hydrocarbons (PAHs) and heterocyclic aromatic amines (HCAs) in gas-grilled beef satay at different temperatures (150, 200, 250, 300, and 350°C). Solid-phase extraction (SPE) was used for sample clean-up. Fifteen PAHs were determined using high performance liquid chromatography with fluorescence detection (HPLC-FLD) and nine HCAs were quantified using liquid chromatography tandem-mass spectrometry (LC-MS/MS) with a gradient programme. The lowest significantly concentrations of PAHs and HCAs were generated at 150°C; the formation of PAHs and HCAs simultaneously increased with temperatures. Benzo[a]pyrene was detected in all samples and increased markedly at 300 and 350°C. The sums of 4 PAHs (PAH4) in marinated beef satay at 300 and 350°C exceeded the maximum level in Commission Regulation (EU) 2015/1125. Significant reductions of polar and non-polar HCAs (except PhIP) were found in marinated beef satay across all temperatures. Overall, PAHs and HCAs showed opposite trends of formation in beef satay with marination.
    Matched MeSH terms: Food Contamination/analysis*
  10. Mercury Bioaccumulation in Tropical Mangrove Wetland Fishes: Evaluating Potential Risk to Coastal Wildlife
    Le DQ, Satyanarayana B, Fui SY, Shirai K
    Biol Trace Elem Res, 2018 Dec;186(2):538-545.
    PMID: 29577182 DOI: 10.1007/s12011-018-1313-2
    The present study, aimed at observing the total concentration of mercury (Hg) in edible finfish species with an implication to human health risk, was carried out from the Setiu mangrove wetlands on the east coast of Peninsular Malaysia. Out of 20 species observed, the highest Hg concentrations were found among carnivores-fish/invertebrate-feeders, followed by omnivores and carnivores-invertebrate-feeders, while the lowest concentrations in herbivores. The Hg concentrations varied widely with fish species and body size, from 0.12 to 2.10 mg/kg dry weight. A positive relationship between body weight and Hg concentration was observed in particular for Toxotes jaculatrix and Tetraodon nigroviridis. Besides the permissible range of Hg concentration up to 0.3 mg/kg (cf. United States Environmental Protection Agency (USEPA)) in majority of species, the carnivore feeders such as Acanthopagrus pacificus, Gerres filamentosus, and Caranx ignobilis have shown excess amounts (> 0.40 mg/kg flesh weight) that raising concerns over the consumption by local people. However, the weekly intake of mercury-estimated through the fish consumption in all three trophic levels-suggests that the present Hg concentrations are still within the range of Provisional Tolerable Weekly Intake (PTWI) reported by the Joint FAO/WHO Expert Committee on Food Additives (JECFA). Perhaps, a multi-species design for Hg monitoring at Setiu wetlands would be able to provide further insights into the level of toxicity transfer among other aquatic organisms and thereby a strong health risk assessment for the local communities.
    Matched MeSH terms: Food Contamination/analysis
  11. Bioaccumulation of heavy metals in maricultured fish, Lates calcarifer (Barramudi), Lutjanus campechanus (red snapper) and Lutjanus griseus (grey snapper)
    Nasyitah Sobihah N, Ahmad Zaharin A, Khairul Nizam M, Ley Juen L, Kyoung-Woong K
    Chemosphere, 2018 Apr;197:318-324.
    PMID: 29360594 DOI: 10.1016/j.chemosphere.2017.12.187
    Mariculture fish contains a rich source of protein, but some species may bioaccumulate high levels of heavy metals, making them unsafe for consumption. This study aims to identify heavy metal concentration in Lates calcarifer (Barramudi), Lutjanus campechanus (Red snapper) and Lutjanus griseus (Grey snapper). Three species of mariculture fish, namely, L. calcarifer, L. campechanus and L. griseus were collected for analyses of heavy metals. The concentration of heavy metal (As, Cd, Cu, Cr, Fe, Pb, Mn, Ni, Se, and Zn) was determined using inductive coupled plasma mass spectrometry (ICP-MS). The distribution of heavy metals mean concentration in muscle is Zn > Fe > As > Se > Cr > Cu > Mn > Pb > Ni > Cd for L. calcarifer, Fe > Zn > Cr > As > Ni > Mn > Se > Cu > Pb > Cd for L. campechanus and Fe > Zn > Cr > Ni > Se > Cu > As > Mn > Pb > Cd for L. griseus. Among all of the species under investigation, the highest concentration of Fe was found in the muscle tissue of L. campechanus (19.985 ± 1.773 mg kg-1) and liver tissue of L. griseus (58.248 ± 8.736 mg kg-1). Meanwhile, L. calcarifer has the lowest concentration of Cd in both muscle (0.007 ± 0.004 mg kg-1) and liver tissue (0.027 ± 0.016 mg kg-1). The heavy metal concentration in muscle tissue is below the permissible limit guidelines stipulated by the Food & Agriculture Organization, 1983 and Malaysia Food Act, 1983. The concentration of heavy metals varies significantly among fish species and tissues. L. campechanus was found to have a higher ability to accumulate heavy metals as compared to the other two species (p food intoxication.
    Matched MeSH terms: Food Contamination/analysis
  12. Molecular beacon-based real-time PCR method for detection of porcine DNA in gelatin and gelatin capsules
    Mohamad NA, Mustafa S, Khairil Mokhtar NF, El Sheikha AF
    J Sci Food Agric, 2018 Sep;98(12):4570-4577.
    PMID: 29505123 DOI: 10.1002/jsfa.8985
    BACKGROUND: The pharmaceutical industry has boosted gelatin consumption worldwide. This is supported by the availability of cost-effective gelatin production from porcine by-products. However, cross-contamination of gelatin materials, where porcine gelatin was unintentionally included in the other animal sources of gelatin, has caused significant concerns about halal authenticity. The real-time polymerase chain reaction (PCR) has enabled a highly specific and sensitive animal species detection method in various food products. Hence, such a technique was employed in the present study to detect and quantify porcine DNA in gelatin using a molecular beacon probe, with differences in performance between mitochondrial (cytochrome b gene) and chromosomal DNA-(MPRE42 repetitive element) based porcine-specific PCR assays being compared.

    RESULTS: A higher sensitivity was observed in chromosomal DNA (MPRE-PCR assay), where this assay allows the detection of gelatin DNA at amounts as as low as 1 pg, whereas mitochondrial DNA (CBH-PCR assay) can only detect at levels down to 10 pg of gelatin DNA. When an analysis with commercial gelatin and gelatin capsule samples was conducted, the same result was observed, with a significantly more sensitive detection being provided by the repetitive element of chromosomal DNA.

    CONCLUSION: The present study has established highly sensitive DNA-based porcine detection systems derived from chromosomal DNA that are feasible for highly processed products such as gelatin and gelatin capsules containing a minute amount of DNA. This sensitive detection method can also be implemented to assist the halal authentication process of various food products available on the market. © 2018 Society of Chemical Industry.

    Matched MeSH terms: Food Contamination/analysis
  13. Bisphenol A and alkylphenols concentrations in selected mariculture fish species from Pulau Kukup, Johor, Malaysia
    Ismail NAH, Wee SY, Aris AZ
    Mar Pollut Bull, 2018 Feb;127:536-540.
    PMID: 29475693 DOI: 10.1016/j.marpolbul.2017.12.043
    Endocrine disrupting compound (EDC) contamination in food is a global concern. Concerning potential environmental and human health exposed to EDCs via food intake, an experiment was conducted on the selected EDCs concentration in the mariculture fish, Trachinotus blochii (golden pomfret), Lutjanus campechanus (snapper), and Lates calcarifer (sea bass) at Pulau Kukup, Johor. Mariculture activity at Pulau Kukup involves active export of fishes to Singapore and Indonesia. The recovery of BPA (bisphenol A), 4OP (4-octylphenol), and 4NP (4-nonylphenol) were 61.54%-93.00%, 16.79%-17.13%, and 61.24%-71.49%, respectively. Relatively high concentration of BPA was recorded in T. blochii (0.322ng/g), followed by L. calcarifer (0.124ng/g) and L. campechanus (0.023ng/g). Furthermore, 4OP and 4NP were detected only in T. blochii at concentrations of 0.084ng/g and 0.078ng/g, respectively. The results of the present study provide insights on monitoring and managing mariculture activity in relation to environmental protection and food safety.
    Matched MeSH terms: Food Contamination/analysis
  14. Concentration of heavy metals in seafood (fishes, shrimp, lobster and crabs) and human health assessment in Saint Martin Island, Bangladesh
    Baki MA, Hossain MM, Akter J, Quraishi SB, Haque Shojib MF, Atique Ullah AKM, et al.
    Ecotoxicol Environ Saf, 2018 Sep 15;159:153-163.
    PMID: 29747150 DOI: 10.1016/j.ecoenv.2018.04.035
    A contaminated aquatic environment may end up in the food chain and pose risks to tourist health in a tourist destination. To assess the health risk for tourists that visit St. Martine Island, which is a popular domestic and foreign tourist destination in Bangladesh, a study is undertaken to analyse the level of heavy metal contamination from chromium (Cr), manganese (Mn), copper (Cu), zinc (Zn), arsenic (As), cadmium (Cd), lead (Pb), mercury (Hg) and iron (Fe) in six of the most consumed fish (L. fasciatus, R. kanagurta, H. nigrescens, P. cuneatus, P. annularis and S. rubrum) and five crustacean species, which consist of a shrimp (P. sculptilis), a lobster (P. versicolor) and three crabs (P. sanguinolentus, T. crenata and M. victor) captured. The samples were analysed for trace metals using atomic absorption spectrometer, and the concentrations of the metals were interpreted using the United State Environmental Protection Agency (USEPA) health risk model. The muscle and carapace/exoskeleton of shrimp, lobster and crabs were analysed and contained various concentrations of Pb, Hg, As, Cr, Cd, Fe, Cu, Zn and Mn. The hierarchy of the heavy metal in marine fish is Fe > Cd > Zn > Pb > Cu > Cr > Mn > Hg. The concentrations of Pb in the species R. kanagurta, H. nigresceus and S. rubrum were above the food safety guideline by Australia, New Zealand and other legislations in most marine fish and crustaceans. Crabs showed higher mean heavy metal concentrations than shrimp and lobster. Acceptable carcinogen ranges were observed in three fish species (R. kanagurata, H. nigresceus and S. rubrum) and one crustacean species (P. sculptilis) samples.
    Matched MeSH terms: Food Contamination/analysis*
  15. Polyphasic approach to the identification and characterization of aflatoxigenic strains of Aspergillus section Flavi isolated from peanuts and peanut-based products marketed in Malaysia
    Norlia M, Jinap S, Nor-Khaizura MAR, Son R, Chin CK, Sardjono
    Int J Food Microbiol, 2018 Oct 03;282:9-15.
    PMID: 29885975 DOI: 10.1016/j.ijfoodmicro.2018.05.030
    Peanuts are widely consumed as the main ingredient in many local dishes in Malaysia. However, the tropical climate in Malaysia (high temperature and humidity) favours the growth of fungi from Aspergillus section Flavi, especially during storage. Most of the species from this section, such as A. flavus, A. parasiticus and A. nomius, are natural producers of aflatoxins. Precise identification of local isolates and information regarding their ability to produce aflatoxins are very important to evaluate the safety of food marketed in Malaysia. Therefore, this study aimed to identify and characterize the aflatoxigenic and non-aflatoxigenic strains of Aspergillus section Flavi in peanuts and peanut-based products. A polyphasic approach, consisting of morphological and chemical characterizations was applied to 128 isolates originating from raw peanuts and peanut-based products. On the basis of morphological characters, 127 positively identified as Aspergillus flavus, and the other as A. nomius. Chemical characterization revealed six chemotype profiles which indicates diversity of toxigenic potential. About 58.6%, 68.5%, and 100% of the isolates are positive for aflatoxins, cyclopiazonic acid and aspergillic acid productions respectively. The majority of the isolates originating from raw peanut samples (64.8%) were aflatoxigenic, while those from peanut-based products were less toxigenic (39.1%). The precise identification of these species may help in developing control strategies for aflatoxigenic fungi and aflatoxin contamination in peanuts, especially during storage. These findings also highlight the possibility of the co-occurrence of other toxins, which could increase the potential toxic effects of peanuts.
    Matched MeSH terms: Food Contamination/analysis*
  16. Comparison assessment between SIM and MRM mode in the analysis of 3-MCPD ester, 2-MCPD ester and glycidyl ester
    Goh KM, Wong YH, Ang MY, Yeo SCM, Abas F, Lai OM, et al.
    Food Res Int, 2019 07;121:553-560.
    PMID: 31108780 DOI: 10.1016/j.foodres.2018.12.013
    The detection of 3- and 2-MCPD ester and glycidyl ester was transformed from selected ion monitoring (SIM) mode to multiple reaction monitoring (MRM) mode by gas chromatography triple quadrupole spectrometry. The derivatization process was adapted from AOCS method Cd 29a-13. The results showed that the coefficient of determination (R2) of all detected compounds obtained from both detection mode was comparable, which falls between 0.997 and 0.999. The limit of detection and quantification (LOD and LOQ) were improved in MRM mode as compared to SIM mode. In MRM mode, the LOD of 3- and 2-MCPD ester was achieved 0.01 mg/kg while the LOQ was 0.05 mg/kg. Besides, LOD and LOQ of glycidyl ester were 0.024 and 0.06 mg/kg respectively. A blank spiked with MCPD esters (0.03, 0.10 and 0.50 mg/kg) and GE (0.06, 0.24 and 1.20 mg/kg) were chosen for repeatability and recovery tests. MRM mode showed better repeatability in area ratio and recovery with relative standard deviation (RSD %) food samples from different category were performed by repeated injections in both detection modes. Briefly, the contaminants from crude palm oil, mustard and olive oil were present in minute amount which below the LOD or LOQ in both detection modes. Sample from chocolate and infant formula products showed certain level of MCPD esters and GE, and their detection was more precisely quantitated based on MRM mode. Besides, margarine products showed a higher level of contaminations due to the high fat content in these products. MRM mode detection was proven to provide precise data with low RSD % in different food matrices. MRM mode detection was robust and selective for MCPD esters and GE analyses, it should be applied to determine the concentration of MCPD esters and GE contaminations in food.
    Matched MeSH terms: Food Contamination/analysis
  17. Quantitative duplex real-time polymerase chain reaction assay with TaqMan probe detects and quantifies Crocodylus porosus in food chain and traditional medicines
    Ahmad Nizar NN, Hossain M, Sultana S, Ahamad MN, Johan MR, Ali ME
    Food Addit Contam Part A Chem Anal Control Expo Risk Assess, 2019 Jun;36(6):825-835.
    PMID: 30945985 DOI: 10.1080/19440049.2019.1584407
    Consumption and exploitation of crocodiles have been rampant for their exotic, nutritive and medicinal attributes. These depredations are alarming and although they have continued to be monitored by wildlife and conservation agencies, unlawful trading of crocodiles shows an increasing trend worldwide. Recently, conventional polymerase chain reaction (PCR) and PCR-restriction fragment length polymorphism (RFLP) assays for crocodile have been documented but they are only suitable for identification and cannot quantify adulterations. We described here a quantitative duplex real-time PCR assay with probes to quantify contributions from Crocodylus porosus materials simultaneously. A very short amplicon size of 127bp was used because longer targets could have been broken down in samples, bringing considerable uncertainty in molecular analysis. We have validated a TaqMan probe-based duplex real-time PCR (qPCR) assay for the detection of 0.004 ng DNA in pure state and 0.1% target meat in model chicken meatball. False negative detection was eliminated through an endogenous control (141-bp site of eukaryotic 18S rRNA). Analysis of 12 model chicken meatballs adulterated with C. porosus reflected 96.3-120.2% target recovery at 0.1-10% adulterations. A validation test of 21 commercial food and traditional medicine (TM) crocodile-based products showed 100% effectiveness. Short amplicon sizes, alternative complementary target, exceptional stability and superior sensitivity suggested the assay could be used for the identification and quantitative determination of C. porosus in any food or TM samples even under degraded conditions.
    Matched MeSH terms: Food Contamination/analysis*
  18. Fulltext Use of headspace-gas chromatography-ion mobility spectrometry to detect volatile fingerprints of palm fibre oil and sludge palm oil in samples of crude palm oil
    Othman A, Goggin KA, Tahir NI, Brodrick E, Singh R, Sambanthamurthi R, et al.
    BMC Res Notes, 2019 Apr 16;12(1):229.
    PMID: 30992056 DOI: 10.1186/s13104-019-4263-7
    OBJECTIVE: The addition of residual oils such as palm fibre oil (PFO) and sludge palm oil (SPO) to crude palm oil (CPO) can be problematic within supply chains. PFO is thought to aggravate the accumulation of monochloropropanediols (MCPDs) in CPO, whilst SPO is an acidic by-product of CPO milling and is not fit for human consumption. Traditional targeted techniques to detect such additives are costly, time-consuming and require highly trained operators. Therefore, we seek to assess the use of gas chromatography-ion mobility spectrometry (GC-IMS) for rapid, cost-effective screening of CPO for the presence of characteristic PFO and SPO volatile organic compound (VOC) fingerprints.

    RESULTS: Lab-pressed CPO and commercial dispatch tank (DT) CPO were spiked with PFO and SPO, respectively. Both additives were detectable at concentrations of 1% and 10% (w/w) in spiked lab-pressed CPO, via seven PFO-associated VOCs and 21 SPO-associated VOCs. DT controls could not be distinguished from PFO-spiked DT CPO, suggesting these samples may have already contained low levels of PFO. DT controls were free of SPO. SPO was detected in all SPO-spiked dispatch tank samples by all 21 of the previously distinguished VOCs and had a significant fingerprint consisting of four spectral regions.

    Matched MeSH terms: Food Contamination/analysis*
  19. Determination of phosphodiesterase 5 (PDE5) inhibitors in instant coffee premixes using liquid chromatography-high-resolution mass spectrometry (LC-HRMS)
    Mohd Yusop AY, Xiao L, Fu S
    Talanta, 2019 Nov 01;204:36-43.
    PMID: 31357306 DOI: 10.1016/j.talanta.2019.05.078
    As a widely consumed beverage, coffee tends to be a target for intentional adulteration. This study describes the application of modified quick, easy, cheap, effective, rugged, and safe (QuEChERS) coupled to liquid chromatography-high-resolution mass spectrometry (LC-HRMS) for simultaneous screening, identification, and quantification of undeclared phosphodiesterase 5 (PDE5) inhibitors in instant coffee premixes (ICPs). The mass spectrometer was operated in auto MS/MS acquisition for simultaneous MS and MS/MS experiments. Qualitative establishments from the suspected-target screening and targeted identification processes led to an unambiguous analyte assignment from the protonated molecule ([M+H]+) precursor ion which is subsequently used for quantification of 23 targeted PDE5 inhibitors. The analytical method validation covered specificity, linearity, range, accuracy, limit of detection (LOD), limit of quantification (LOQ), precisions, matrix effect (ME), and extraction recovery (RE). The specificity was established using the optimised chromatographic separation as well as the distinguishable [M+H]+ precursor ion. The linearity of each target analyte was demonstrated with a coefficient of determination (r2) of >0.9960 over the expected range of sample concentrations. The accuracy ranged from 88.1%-119.3% with LOD and LOQ of <70 ng/mL and 80 ng/mL, respectively. Excellent precisions were established within 0.4%-9.1% of the relative standard deviation. An insignificant ME within -5.2% to +8.7% was achieved using three different strategies of chromatography, sample extraction, and sample dilution. The RE was good for all target analytes within 84.7%-123.5% except for N-desethylacetildenafil at low (53.8%) and medium (65.1%) quality control levels. The method was successfully applied to 25 samples of ICPs where 17 of them were found to be adulterated with PDE5 inhibitors and their analogues. Further quantification revealed the total amount of these adulterants ranged from 2.77 to 121.64 mg per sachet.
    Matched MeSH terms: Food Contamination/analysis*
  20. Verification and evaluation of monochloropropanediol (MCPD) esters and glycidyl esters in palm oil products of different regions in Malaysia
    Abd Razak RA, Ahmad Tarmizi AH, Abdul Hammid AN, Kuntom A, Ismail IS, Sanny M
    Food Addit Contam Part A Chem Anal Control Expo Risk Assess, 2019 Nov;36(11):1626-1636.
    PMID: 31437078 DOI: 10.1080/19440049.2019.1654139
    This study was conducted to investigate on the effect of different sampling regions of palm-refined oils and fats on the 2- and 3-monochloropropanediol fatty acid esters (MCPDE) and glycidol fatty acid esters (GE) levels. The American Oil Chemists' Society (AOCS) Official Method Cd 29a-13 on the determination of MCPDE and GE in edible oils and fats by acid transesterification was successfully verified and optimised, with slight modification using 7890A Agilent GC system equipped with 5975C quadrupole detector. The determined limits of detection (LOD) for MCPDE were 0.02 mg kg-1 and 0.05 mg kg-1 for GE. The method performance has showed good recovery between 80% and 120% for all pertinent compounds with seven replicates assayed in three separate days. Round robin test with two European laboratories, i.e. Eurofins and SGS, has shown compliance results with those of the present study. Among the sampling regions, only one refinery located in the central region of Malaysia showed a significant increment of the MCPDE and GE levels after refining process. The GE level averaging at 2.5 mg kg-1 was slightly higher than that of 3-MCPDE averaging at 1.3 mg kg-1. Both esters were preferentially partitioned into the liquid phase rather than the solid phase after fractionation. However, the overall results exhibited no direct correlation between the esters content and the different sampling locations of the palm oil products in Malaysia. Analysis of total chlorine content also displayed significant variations between sampling locations which clearly show its effect on the chlorine content in the CPO samples.
    Matched MeSH terms: Food Contamination/analysis*
Related Terms
Filters
Contact Us

Please provide feedback to Administrator (afdal@afpm.org.my)

External Links