MyMedR

Displaying publications 161 - 180 of 996 in total

Abstract:

Sort:

Fulltext Phage display creates innovative applications to combat hepatitis B virus

Tan WS, Ho KL

World J Gastroenterol, 2014 Sep 7;20(33):11650-70.
PMID: 25206271 DOI: 10.3748/wjg.v20.i33.11650

Hepatitis B virus (HBV) has killed countless lives in human history. The invention of HBV vaccines in the 20(th) century has reduced significantly the rate of the viral infection. However, currently there is no effective treatment for chronic HBV carriers. Newly emerging vaccine escape mutants and drug resistant strains have complicated the viral eradication program. The entire world is now facing a new threat of HBV and human immunodeficiency virus co-infection. Could phage display provide solutions to these life-threatening problems? This article reviews critically and comprehensively the innovative and potential applications of phage display in the development of vaccines, therapeutic agents, diagnostic reagents, as well as gene and drug delivery systems to combat HBV. The application of phage display in epitope mapping of HBV antigens is also discussed in detail. Although this review mainly focuses on HBV, the innovative applications of phage display could also be extended to other infectious diseases.

Matched MeSH terms: Mutation
An unexpected presentation of very severe hypertriglyceridemia in a boy with Coffin-Lowry syndrome: a case report

Tan SL, Ahmad Narihan MGB, Koa AJ

BMC Pediatr, 2023 Oct 28;23(1):541.
PMID: 37898736 DOI: 10.1186/s12887-023-04376-5

BACKGROUND: Coffin-Lowry syndrome (CLS) is a rare X-linked condition with intellectual disability, growth retardation, characteristic facies and skeletal anomalies. To date, hypertriglyceridemia has not been reported in literature to be associated with CLS.
CASE PRESENTATION: Herein, we report a case of very severe hypertriglyceridemia 32 mmol/L (2834 mg/dL) detected incidentally at three months old in an otherwise well boy born late preterm with intrauterine growth restriction, when he presented with lipaemic plasma. He was later diagnosed with CLS. No pathogenic mutations were found for hypertriglyceridemia, and no secondary causes could explain his very severe hypertriglyceridemia.
CONCLUSIONS: The very severe hypertriglyceridemia in this case may appear to be a serious presentation of an unrecognised clinical feature of CLS, further expanding its phenotype.

Matched MeSH terms: Mutation
Fulltext Sequence variation in the cytochrome oxidase subunit I and II genes of two commonly found blow fly species, Chrysomya megacephala (Fabricius) and Chrysomya rufifacies (Macquart) (Diptera: Calliphoridae) in Malaysia

Tan SH, Aris EM, Surin J, Omar B, Kurahashi H, Mohamed Z

Trop Biomed, 2009 Aug;26(2):173-81.
PMID: 19901904

The mitochondiral DNA region encompassing the cytochrome oxidase subunit I (COI) and cytochrome oxidase subunit II (COII) genes of two Malaysian blow fly species, Chrysomya megacephala (Fabricius) and Chrysomya rufifacies (Macquart) were studied. This region, which spans 2303bp and includes the COI, tRNA leucine and partial COII was sequenced from adult fly and larval specimens, and compared. Intraspecific variations were observed at 0.26% for Ch. megacephala and 0.17% for Ch. rufifacies, while sequence divergence between the two species was recorded at a minimum of 141 out of 2303 sites (6.12%). Results obtained in this study are comparable to published data, and thus support the use of DNA sequence to facilitate and complement morphology-based species identification.

Matched MeSH terms: Point Mutation
Fulltext Role of Fimbriae, Flagella and Cellulose on the Attachment of Salmonella Typhimurium ATCC 14028 to Plant Cell Wall Models

Tan MS, White AP, Rahman S, Dykes GA

PLoS One, 2016;11(6):e0158311.
PMID: 27355584 DOI: 10.1371/journal.pone.0158311

Cases of foodborne disease caused by Salmonella are frequently associated with the consumption of minimally processed produce. Bacterial cell surface components are known to be important for the attachment of bacterial pathogens to fresh produce. The role of these extracellular structures in Salmonella attachment to plant cell walls has not been investigated in detail. We investigated the role of flagella, fimbriae and cellulose on the attachment of Salmonella Typhimurium ATCC 14028 and a range of isogenic deletion mutants (ΔfliC fljB, ΔbcsA, ΔcsgA, ΔcsgA bcsA and ΔcsgD) to bacterial cellulose (BC)-based plant cell wall models [BC-Pectin (BCP), BC-Xyloglucan (BCX) and BC-Pectin-Xyloglucan (BCPX)] after growth at different temperatures (28°C and 37°C). We found that all three cell surface components were produced at 28°C but only the flagella was produced at 37°C. Flagella appeared to be most important for attachment (reduction of up to 1.5 log CFU/cm2) although both cellulose and fimbriae also aided in attachment. The csgD deletion mutant, which lacks both cellulose and fimbriae, showed significantly higher attachment as compared to wild type cells at 37°C. This may be due to the increased expression of flagella-related genes which are also indirectly regulated by the csgD gene. Our study suggests that bacterial attachment to plant cell walls is a complex process involving many factors. Although flagella, cellulose and fimbriae all aid in attachment, these structures are not the only mechanism as no strain was completely defective in its attachment.

Matched MeSH terms: Mutation
No difference in the occurrence of mismatch repair defects and APC and CTNNB1 genes mutation in a multi-racial colorectal carcinoma patient cohort

Tan LP, Ng BK, Balraj P, Lim PK, Peh SC

Pathology, 2007 Apr;39(2):228-34.
PMID: 17454753

BACKGROUND AND AIMS: Colorectal cancers of different subtypes involve different pathogenic pathways like the Wnt and the mutator pathways. In this study, we screened 73 colorectal cancer cases from a multi-racial group for genetic and expression profile defects with the aim of correlating these with patients' clinicopathological characteristics.
METHODS: Mutation screening of the entire coding region of APC and exon 3 of CTNNB1, loss of heterozygosity (LOH) of APC, and microsatellite instability (MSI) status were assessed for 44 patients with available paired frozen normal and tumour tissues. In addition, 29 cases with available paraffin embedded tumour blocks were screened for mutation in exon 3 of CTNNB1, the APC mutation cluster region (codon 1286-1513), and hMLH1, hMSH2, hMSH6 protein expressions by immunohistochemistry method.
RESULTS: In our study, 15/73 cases showed APC mutations (20.5%), 1/73 cases had CTNNB1 mutation (1.4%), 5/32 cases had APC LOH (15.6%), and 16/70 (22.9%) cases revealed at least some form of mismatch repair (MMR) defect. Tumour grade (poor differentiation) was found to correlate significantly with right-sided tumour and mucinous histology (p = 0.01879 and 0.00320, respectively). Patients of younger age (below 45 years) more often had tumours of mucinous histology (p = 0.00014), while patients of older age (above 75 years) more often had tumours on the right side of the colon (p = 0.02448). Tumours of the mucinous histology subtype often had MMR defects (p = 0.02686). There was no difference in the occurrence of APC and CTNNB1 mutations and MMR defects found within our multi-racial colorectal cancer patient cohort.
CONCLUSION: Our findings support the notion that racial factor may not be related to the occurrence of MMR defects and APC and CTNNB1 mutations in our multi-racial patient cohort.

Matched MeSH terms: DNA Mutational Analysis; Mutation
Fulltext Full-length sequence analysis of chloroquine resistance transporter gene in Plasmodium falciparum isolates from Sabah, Malaysia

Tan LL, Lau TY, Timothy W, Prabakaran D

ScientificWorldJournal, 2014;2014:935846.
PMID: 25574497 DOI: 10.1155/2014/935846

Chloroquine resistance (CQR) in falciparum malaria was identified to be associated with several mutations in the chloroquine resistance transporter gene (pfcrt) that encodes the transmembrane transporter in digestive vacuole membrane of the parasite. This study aimed to investigate the point mutations across the full-length pfcrt in Plasmodium falciparum isolates in Sabah, Malaysia. A total of 31 P. falciparum positive samples collected from Keningau, Kota Kinabalu, and Kudat, Sabah, were analyzed. pfcrt was PCR amplified and cloned prior to sequence analysis. This study showed that all the previously described 10 point mutations associated with CQR at codons 72, 74, 75, 76, 97, 220, 271, 326, 356, and 371 were found with different prevalence. Besides, two novel point mutations, I166V and H273N, were identified with 22.5% and 19.3%, respectively. Three haplotypes, namely, CVMNK (29%), CVIET (3.2%), and SVMNT (67.7%), were identified. High prevalence of SVMNT among P. falciparum isolates from Sabah showed that these isolates are closer to the P. falciparum isolates from Papua New Guinea rather than to the more proximal Southeast Asian CVIET haplotype. Full-length analysis of pfcrt showed that chloroquine resistant P. falciparum in Sabah is still prevalent despite the withdrawal of chloroquine usage since 1979.

Matched MeSH terms: Point Mutation/genetics
Combine-ARMS: a rapid and cost-effective protocol for molecular characterization of beta-thalassemia in Malaysia

Tan KL, Tan JA, Wong YC, Wee YC, Thong MK, Yap SF

Genet. Test., 2001;5(1):17-22.
PMID: 11336396 DOI: 10.1089/109065701750168626

Beta-thalassemia major patients have chronic anemia and are dependent on blood transfusions to sustain life. Molecular characterization and prenatal diagnosis of beta3-thalassemia is essential in Malaysia because about 4.5% of the population are heterozygous carriers for beta-thalassemia. The high percentage of compound heterozygosity (47.62%) found in beta-thalassemia major patients in the Thalassaemia Registry, University of Malaya Medical Centre (UMMC), Malaysia, also supports a need for rapid, economical, and sensitive protocols for the detection of beta-thalassemia mutations. Molecular characterization of beta-thalassemia mutations in Malaysia is currently carried out using ARMS, which detects a single beta-thalassemia mutation per PCR reaction. We developed and evaluated Combine amplification refractory mutation system (C-ARMS) techniques for efficient molecular detection of two to three beta-thalassemia mutations in a single PCR reaction. Three C-ARMS protocols were evaluated and established for molecular characterization of common beta-thalassemia mutations in the Malay and Chinese ethnic groups in Malaysia. Two C-ARMS protocols (cd 41-42/IVSII #654 and -29/cd 71-72) detected the beta-thalassemia mutations in 74.98% of the Chinese patients studied. The CARMS for cd 41-42/IVSII #654 detected beta-thalassemia mutations in 72% of the Chinese families. C-ARMS for cd 41-42/IVSI #5/cd 17 allowed detection of beta-thalassemia mutations in 36.53% of beta-thalassemia in the Malay patients. C-ARMS for cd 41-42/IVSI #5/cd 17 detected beta-thalassemia in 45.54% of the Chinese patients. We conclude that C-ARMS with the ability to detect two to three mutations in a single reaction provides more rapid and cost-effective protocols for beta-thalassemia prenatal diagnosis and molecular analysis programs in Malaysia.

Matched MeSH terms: DNA Mutational Analysis/economics*; DNA Mutational Analysis/methods*; Mutation/genetics*
Fulltext Independent Emergence of the Cosmopolitan Asian Chikungunya Virus, Philippines 2012

Tan KK, Sy AK, Tandoc AO, Khoo JJ, Sulaiman S, Chang LY, et al.

Sci Rep, 2015 Jul 23;5:12279.
PMID: 26201250 DOI: 10.1038/srep12279

Outbreaks involving the Asian genotype Chikungunya virus (CHIKV) caused over one million infections in the Americas recently. The outbreak was preceded by a major nationwide outbreak in the Philippines. We examined the phylogenetic and phylogeographic relationships of representative CHIKV isolates obtained from the 2012 Philippines outbreak with other CHIKV isolates collected globally. Asian CHIKV isolated from the Philippines, China, Micronesia and Caribbean regions were found closely related, herein denoted as Cosmopolitan Asian CHIKV (CACV). Three adaptive amino acid substitutions in nsP3 (D483N), E1 (P397L) and E3 (Q19R) were identified among CACV. Acquisition of the nsP3-483N mutation in Compostela Valley followed by E1-397L/E3-19R in Laguna preceded the nationwide spread in the Philippines. The China isolates possessed two of the amino acid substitutions, nsP3-D483N and E1-P397L whereas the Micronesian and Caribbean CHIKV inherited all the three amino acid substitutions. The unique amino acid substitutions observed among the isolates suggest multiple independent virus dissemination events. The possible biological importance of the specific genetic signatures associated with the rapid global of the virus is not known and warrant future in-depth study and epidemiological follow-up. Molecular evidence, however, supports the Philippines outbreak as the possible origin of the CACV.

Matched MeSH terms: Mutation/genetics
Fulltext Paediatric Gliomas: BRAF and Histone H3 as Biomarkers, Therapy and Perspective of Liquid Biopsies

Tan JY, Wijesinghe IVS, Alfarizal Kamarudin MN, Parhar I

Cancers (Basel), 2021 Feb 04;13(4).
PMID: 33557011 DOI: 10.3390/cancers13040607

Paediatric gliomas categorised as low- or high-grade vary markedly from their adult counterparts, and denoted as the second most prevalent childhood cancers after leukaemia. As compared to adult gliomas, the studies of diagnostic and prognostic biomarkers, as well as the development of therapy in paediatric gliomas, are still in their infancy. A body of evidence demonstrates that B-Raf Proto-Oncogene or V-Raf Murine Sarcoma Viral Oncogene Homolog B (BRAF) and histone H3 mutations are valuable biomarkers for paediatric low-grade gliomas (pLGGs) and high-grade gliomas (pHGGs). Various diagnostic methods involving fluorescence in situ hybridisation, whole-genomic sequencing, PCR, next-generation sequencing and NanoString are currently used for detecting BRAF and histone H3 mutations. Additionally, liquid biopsies are gaining popularity as an alternative to tumour materials in detecting these biomarkers, but still, they cannot fully replace solid biopsies due to several limitations. Although histone H3 mutations are reliable prognosis biomarkers in pHGGs, children with these mutations have a dismal prognosis. Conversely, the role of BRAF alterations as prognostic biomarkers in pLGGs is still in doubt due to contradictory findings. The BRAF V600E mutation is seen in the majority of pLGGs (as seen in pleomorphic xanthoastrocytoma and gangliomas). By contrast, the H3K27M mutation is found in the majority of paediatric diffuse intrinsic pontine glioma and other midline gliomas in pHGGs. pLGG patients with a BRAF V600E mutation often have a lower progression-free survival rate in comparison to wild-type pLGGs when treated with conventional therapies. BRAF inhibitors (Dabrafenib and Vemurafenib), however, show higher overall survival and tumour response in BRAF V600E mutated pLGGs than conventional therapies in some studies. To date, targeted therapy and precision medicine are promising avenues for paediatric gliomas with BRAF V600E and diffuse intrinsic pontine glioma with the H3K27M mutations. Given these shortcomings in the current treatments of paediatric gliomas, there is a dire need for novel therapies that yield a better therapeutic response. The present review discusses the diagnostic tools and the perspective of liquid biopsies in the detection of BRAF V600E and H3K27M mutations. An in-depth understanding of these biomarkers and the therapeutics associated with the respective challenges will bridge the gap between paediatric glioma patients and the development of effective therapies.

Matched MeSH terms: Mutation
Fulltext Genome sequence analysis of multidrug-resistant Mycobacterium tuberculosis from Malaysia

Tan JL, Simbun A, Chan KG, Ngeow YF

Sci Data, 2020 05 05;7(1):135.
PMID: 32371951 DOI: 10.1038/s41597-020-0475-x

Mycobacterium tuberculosis (MTB) is commonly used as a model to study pathogenicity and multiple drug resistance in bacteria. These MTB characteristics are highly dependent on the evolution and phylogeography of the bacterium. In this paper, we describe 15 new genomes of multidrug-resistant MTB (MDRTB) from Malaysia. The assessments and annotations on the genome assemblies suggest that strain differences are due to lineages and horizontal gene transfer during the course of evolution. The genomes show mutations listed in current drug resistance databases and global MTB collections. This genome data will augment existing information available for comparative genomic studies to understand MTB drug resistance mechanisms and evolution.

Matched MeSH terms: Mutation
Fulltext Genomic Comparisons Reveal Microevolutionary Differences in Mycobacterium abscessus Subspecies

Tan JL, Ng KP, Ong CS, Ngeow YF

Front Microbiol, 2017;8:2042.
PMID: 29109707 DOI: 10.3389/fmicb.2017.02042

Mycobacterium abscessus, a rapid-growing non-tuberculous mycobacterium, has been the cause of sporadic and outbreak infections world-wide. The subspecies in M. abscessus complex (M. abscessus, M. massiliense, and M. bolletii) are associated with different biologic and pathogenic characteristics and are known to be among the most frequently isolated opportunistic pathogens from clinical material. To date, the evolutionary forces that could have contributed to these biological and clinical differences are still unclear. We compared genome data from 243 M. abscessus strains downloaded from the NCBI ftp Refseq database to understand how the microevolutionary processes of homologous recombination and positive selection influenced the diversification of the M. abscessus complex at the subspecies level. The three subspecies are clearly separated in the Minimum Spanning Tree. Their MUMi-based genomic distances support the separation of M. massiliense and M. bolletii into two subspecies. Maximum Likelihood analysis through dN/dS (the ratio of number of non-synonymous substitutions per non-synonymous site, to the number of synonymous substitutions per synonymous site) identified distinct genes in each subspecies that could have been affected by positive selection during evolution. The results of genome-wide alignment based on concatenated locally-collinear blocks suggest that (a) recombination has affected the M. abscessus complex more than mutation and positive selection; (b) recombination occurred more frequently in M. massiliense than in the other two subspecies; and (c) the recombined segments in the three subspecies have come from different intra-species and inter-species origins. The results lead to the identification of possible gene sets that could have been responsible for the subspecies-specific features and suggest independent evolution among the three subspecies, with recombination playing a more significant role than positive selection in the diversification among members in this complex.

Matched MeSH terms: Mutation
Transfusion-dependent thalassemia in Northern Sarawak: a molecular study to identify different genotypes in the multi-ethnic groups and the importance of genomic sequencing in unstudied populations

Tan JA, Chin SS, Ong GB, Mohamed Unni MN, Soosay AE, Gudum HR, et al.

Public Health Genomics, 2015;18(1):60-4.
PMID: 25412720 DOI: 10.1159/000368342

BACKGROUND: Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak.
METHODS: Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing.
RESULTS: Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients.
CONCLUSION: The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations.

Matched MeSH terms: Mutation
Interaction of Hb South Florida (codon 1; GTG-->ATG) and HbE, with beta-thalassemia (IVS1-1; G-->A): expression of different clinical phenotypes

Tan JA, Tan KL, Omar KZ, Chan LL, Wee YC, George E

Eur J Pediatr, 2009 Sep;168(9):1049-54.
PMID: 19034506 DOI: 10.1007/s00431-008-0877-9

INTRODUCTION: Interactions of different hemoglobin variants with thalassemia alleles can result in various clinical phenotypes. HbE-beta-thalassemia generally manifests with severe anemia where individuals exhibit beta-thalassemia major with regular blood transfusions or beta-thalassemia intermedia with periodic blood transfusions. This study presents a unique Malay family with three beta-globin gene defects-HbE, Hb South Florida, and IVS1-1 (G-->A).
MATERIALS AND METHODS: HbE activates a cryptic splice site that produces non-functional mRNAs. Hb South Florida is a rare beta-hemoglobin variant, and its interactions with other beta-thalassemia alleles have not been reported. IVS1-1 is a Mediterranean mutation that affects mRNA processing giving rise to beta(o)-thalassemia.
RESULTS AND DISCUSSION: Fifteen mutations along the beta-globin gene complex were analyzed using the amplification refractory mutation system. Hb South Florida was identified by direct sequencing using genomic DNA.
CONCLUSION: The affected child with HbE/IVS1-1 produced a beta-thalassemia major phenotype. Compound heterozygosity for Hb South Florida/IVS1-1 produced a beta-thalassemia carrier phenotype in the mother.

Matched MeSH terms: Point Mutation/genetics*
Characterisation and confirmation of rare beta-thalassaemia mutations in the Malay, Chinese and Indian ethnic groups in Malaysia

Tan JA, Chin PS, Wong YC, Tan KL, Chan LL, George E

Pathology, 2006 Oct;38(5):437-41.
PMID: 17008283

In Malaysia, about 4.5% of the Malay and Chinese populations are heterozygous carriers of beta-thalassaemia. The initial identification of rare beta-globin gene mutations by genomic sequencing will allow the development of simpler and cost-effective PCR-based techniques to complement the existing amplification refractory mutation system (ARMS) and gap-PCR used for the identification of beta-thalassaemia mutations.

Matched MeSH terms: DNA Mutational Analysis; Mutation*
Molecular defects in the beta-globin gene identified in different ethnic groups/populations during prenatal diagnosis for beta-thalassemia: a Malaysian experience

Tan JA, George E, Tan KL, Chow T, Tan PC, Hassan J, et al.

Clin Exp Med, 2004 Dec;4(3):142-7.
PMID: 15599663 DOI: 10.1007/s10238-004-0048-x

Beta-thalassemia is the most-common genetic disorder of hemoglobin synthesis in Malaysia, and about 4.5% of the population are heterozygous carriers of the disorder. Prenatal diagnosis was performed for 96 couples using the Amplification Refractory Mutation System and Gap-Polymerase Chain Reaction. We identified 17 beta-globin defects-initiation codon for translation (T-G), -29 (A-G), -28 (A-G), CAP +1 (A-C), CD 8/9 (+G), CD 15 (G-A), CD 17 (A-T), CD 19 (A-G), Hb E (G-A), IVS1-1 (G-T), IVS1-5 (G-C), CD 41/42 (-CTTT), CD 71-72 (+A), IVS2-654 (CT), poly A(A-G), 100-kb Ggamma(Agammadeltabeta) degrees and 45-kb Filipino deletions. The 192 beta-alleles studied comprised Chinese (151 patients), Malay (21), Orang Asli from East Malaysia (15), Filipino (1), Indian (1), Indonesian Chinese (2), and Thai (1). In the Chinese, 2 beta-globin defects at CD 41/42 and IVS2-654 were responsible for 74% of beta-thalassemia. beta-mutations at CD 19, IVS1-1 (G-T), IVS1-5, poly A, and hemoglobin E caused 76% of the hemoglobin disorders in the Malays. The Filipino 45-kb deletion caused 73.3% of bthalassemia in the Orang Asli. Using genomic sequencing, the rare Chinese beta-mutation at CD 43 (G-T) was confirmed in 2 Chinese, and the Mediterranean mutation IVS1-1 (G-A) was observed in a Malay beta-thalassemia carrier. The beta-globin mutations confirmed in this prenatal diagnosis study were heterogenous and 65 (68%) couples showed a different globin defect from each other. The use of specific molecular protocols has allowed rapid and successful prenatal diagnosis of beta-thalassemia in Malaysia.

Matched MeSH terms: DNA Mutational Analysis; Mutation/genetics
Fulltext Generalized epilepsy with febrile seizure plus (GEFS+) spectrum: Novel de novo mutation of SCN1A detected in a Malaysian patient

Tan EH, Yusoff AA, Abdullah JM, Razak SA

J Pediatr Neurosci, 2012 May;7(2):123-5.
PMID: 23248692 DOI: 10.4103/1817-1745.102575

In this report, we describe a 15-year-old Malaysian male patient with a de novo SCN1A mutation who experienced prolonged febrile seizures after his first seizure at 6 months of age. This boy had generalized tonic clonic seizure (GTCS) which occurred with and without fever. Sequencing analysis of voltage-gated sodium channel a1-subunit gene, SCN1A, confirmed a homozygous A to G change at nucleotide 5197 (c.5197A > G) in exon 26 resulting in amino acid substitution of asparagines to aspartate at codon 1733 of sodium channel. The mutation identified in this patient is located in the pore-forming loop of SCN1A and this case report suggests missense mutation in pore-forming loop causes generalized epilepsy with febrile seizure plus (GEFS+) with clinically more severe neurologic phenotype including intellectual disabilities (mental retardation and autism features) and neuropsychiatric disease (anxiety disorder).

Matched MeSH terms: Mutation, Missense
De-novo mutations and genetic variation in the SCN1A gene in Malaysian patients with generalized epilepsy with febrile seizures plus (GEFS+)

Tan EH, Razak SA, Abdullah JM, Mohamed Yusoff AA

Epilepsy Res, 2012 Dec;102(3):210-5.
PMID: 22944210 DOI: 10.1016/j.eplepsyres.2012.08.004

Generalized epilepsy with febrile seizures plus (GEFS+) comprises a group of clinically and genetically heterogeneous epilepsy syndrome. Here, we provide the first report of clinical presentation and mutational analysis of SCN1A gene in 36 Malaysian GEFS+ patients. Mutational analysis of SCN1A gene revealed twenty seven sequence variants (missense mutation and silent polymorphism also intronic polymorphism), as well as 2 novel de-novo mutations were found in our patients at coding regions, c.5197A>G (N1733D) and c.4748A>G (H1583R). Our findings provide potential genetic insights into the pathogenesis of GEFS+ in Malaysian populations concerning the SCN1A gene mutations.

Matched MeSH terms: DNA Mutational Analysis; Mutation/genetics*
Singapore Human Mutation/Polymorphism Database: a country-specific database for mutations and polymorphisms in inherited disorders and candidate gene association studies

Tan EC, Loh M, Chuon D, Lim YP

Hum Mutat, 2006 Mar;27(3):232-5.
PMID: 16429432

There is a need for country/population-specific databases because the existence of population-specific mutations for single gene disorders is well documented, and there is also good evidence for ethnic differences in the frequencies of genetic variations involved in complex disorders. Thus the Singapore Human Mutation/Polymorphism Database (SHMPD) was created to provide clinicians and scientists access to a central genetic database for the Singapore population. The data catalogued in the database include mutations identified in Singapore for Mendelian diseases, and frequencies of polymorphisms that have been investigated in either healthy controls or samples associated with specific phenotypes. Data from journal articles identified by searches in PubMed and other online resources, and via personal communications with researchers were compiled and assembled into a single database. Genes are categorized alphabetically and are also searchable by name and disease. The information provided for each variant of the gene includes the protein encoded, phenotype association, gender, size, and ethnic origin of the sample, as well as the reported genotype and allele frequencies, and direct links to the corresponding abstracts on PubMed. Our database will facilitate molecular diagnosis of Mendelian disorders and improve study designs for complex traits. It will be useful not only for researchers in Singapore, but also for those in countries with similar ethnic backgrounds, such as China, Taiwan, Hong Kong, Indonesia, and Malaysia.

Matched MeSH terms: Mutation*
VP1 residues around the five-fold axis of enterovirus A71 mediate heparan sulfate interaction

Tan CW, Sam IC, Lee VS, Wong HV, Chan YF

Virology, 2017 01 15;501:79-87.
PMID: 27875780 DOI: 10.1016/j.virol.2016.11.009

Enterovirus A71 (EV-A71) is a neurotropic enterovirus that uses heparan sulfate as an attachment receptor. The molecular determinants of EV-A71-heparan sulfate interaction are unknown. With In silico heparin docking and mutagenesis of all possible lysine residues in VP1, we identified that K162, K242 and K244 are responsible for heparin interaction and inhibition. EV-A71 mutants with K242A and K244A rapidly acquired compensatory mutations, T100K or E98A, and Q145R-T237N respectively, which restored the heparin-binding phenotype. Both VP1-98 and VP1-145 modulates heparin binding. Heparin-binding phenotype was completely abolished with VP1-E98-E145, but was restored by an E98K or E145Q substitution. During cell culture adaptation, EV-A71 rapidly acquired K98 or Q/G145 to restore the heparin-binding phenotype. Together with next-generation sequencing analysis, our results implied that EV-A71 has high genetic plasticity by modulating positively-charged residues at the five-fold axis during in vitro heparin adaptation. Our finding has impact on EV-A71 vaccine production, evolutionary studies and pathogenesis.

Matched MeSH terms: Mutation
Structural and kinetic studies of a novel nerol dehydrogenase from Persicaria minor, a nerol-specific enzyme for citral biosynthesis

Tan CS, Hassan M, Mohamed Hussein ZA, Ismail I, Ho KL, Ng CL, et al.

Plant Physiol Biochem, 2018 Feb;123:359-368.
PMID: 29304481 DOI: 10.1016/j.plaphy.2017.12.033

Geraniol degradation pathway has long been elucidated in microorganisms through bioconversion studies, yet weakly characterised in plants; enzyme with specific nerol-oxidising activity has not been reported. A novel cDNA encodes nerol dehydrogenase (PmNeDH) was isolated from Persicaria minor. The recombinant PmNeDH (rPmNeDH) is a homodimeric enzyme that belongs to MDR (medium-chain dehydrogenases/reductases) superfamily that catalyses the first oxidative step of geraniol degradation pathway in citral biosynthesis. Kinetic analysis revealed that rPmNeDH has a high specificity for allylic primary alcohols with backbone ≤10 carbons. rPmNeDH has ∼3 fold higher affinity towards nerol (cis-3,7-dimethyl-2,6-octadien-1-ol) than its trans-isomer, geraniol. To our knowledge, this is the first alcohol dehydrogenase with higher preference towards nerol, suggesting that nerol can be effective substrate for citral biosynthesis in P. minor. The rPmNeDH crystal structure (1.54 Å) showed high similarity with enzyme structures from MDR superfamily. Structure guided mutation was conducted to describe the relationships between substrate specificity and residue substitutions in the active site. Kinetics analyses of wild-type rPmNeDH and several active site mutants demonstrated that the substrate specificity of rPmNeDH can be altered by changing any selected active site residues (Asp280, Leu294 and Ala303). Interestingly, the L294F, A303F and A303G mutants were able to revamp the substrate preference towards geraniol. Furthermore, mutant that exhibited a broader substrate range was also obtained. This study demonstrates that P. minor may have evolved to contain enzyme that optimally recognise cis-configured nerol as substrate. rPmNeDH structure provides new insights into the substrate specificity and active site plasticity in MDR superfamily.

Matched MeSH terms: Mutation, Missense

Filters

Please provide feedback to Administrator (afdal@afpm.org.my)

External Links