Displaying publications 1 - 20 of 34 in total

Abstract:
Sort:
  1. George E, Ann TJ
    Med J Malaysia, 2010 Dec;65(4):256-60.
    PMID: 21901940 MyJurnal
    The haemoglobinopathies and thalassemias represent the most common inherited monogenic disorders in the world. Beta-thalassaemia major is an ongoing public health problem in Malaysia. Prior to 2004, the country had no national policy for screening and registry for thalassemia. In the absence of a national audit, the true figure of the extent of thalassemia in the Malaysian population was largely presumptive from micro-mapping studies from various research workers in the country. The estimated carrier rate for beta-thalassemia in Malaysia is 3.5-4%. There were 4768 transfusion dependent thalassemia major patients as of May 2010 (Data from National Thalassemia Registry).
  2. Tan JA, Lee PC, Wee YC, Tan KL, Mahali NF, George E, et al.
    PMID: 20871816 DOI: 10.1155/2010/706872
    Thalassemia can lead to severe transfusion-dependent anemia, and it is the most common genetic disorder in Malaysia. This paper aims to determine the prevalence of thalassemia in the Kadazandusuns, the largest indigenous group in Sabah, East Malaysia. α- and β-thalassemia were confirmed in 33.6% and 12.8%, of the individuals studied respectively. The high prevalence of α- and β-thalassemia in the Kadazandusuns indicates that thalassemia screening, genetic counseling, and prenatal diagnosis should be included as part of their healthcare system. This preliminary paper serves as a baseline for further investigations into the health and genetic defects of the major indigenous population in Sabah, East Malaysia.
  3. Sumera A, Radhakrishnan A, Baba AA, George E
    Blood Cells Mol. Dis., 2015 Apr;54(4):348-52.
    PMID: 25648458 DOI: 10.1016/j.bcmd.2015.01.008
    Thalassemia is known as a diverse single gene disorder, which is prevalent worldwide. The molecular chaperones are set of proteins that help in two important processes while protein synthesis and degradation include folding or unfolding and assembly or disassembly, thereby helping in cell homeostasis. This review recaps current knowledge regarding the role of molecular chaperones in thalassemia, with a focus on beta thalassemia.
  4. Tan JA, Chin SS, Ong GB, Mohamed Unni MN, Soosay AE, Gudum HR, et al.
    Public Health Genomics, 2015;18(1):60-4.
    PMID: 25412720 DOI: 10.1159/000368342
    BACKGROUND: Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak.
    METHODS: Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing.
    RESULTS: Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients.
    CONCLUSION: The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations.
  5. Tan JA, Kho SL, Ngim CF, Chua KH, Goh AS, Yeoh SL, et al.
    Sci Rep, 2016 06 08;6:26994.
    PMID: 27271331 DOI: 10.1038/srep26994
    Haemoglobin (Hb) Adana (HBA2:c.179>A) interacts with deletional and nondeletional α-thalassaemia mutations to produce HbH disorders with varying clinical manifestations from asymptomatic to severe anaemia with significant hepatosplenomegaly. Hb Adana carriers are generally asymptomatic and haemoglobin subtyping is unable to detect this highly unstable α-haemoglobin variant. This study identified 13 patients with compound heterozygosity for Hb Adana with either the 3.7 kb gene deletion (-α(3.7)), Hb Constant Spring (HbCS) (HBA2:c.427T>C) or Hb Paksé (HBA2:429A>T). Multiplex Amplification Refractory Mutation System was used for the detection of five deletional and six nondeletional α-thalassaemia mutations. Duplex-PCR was used to confirm Hb Paksé and HbCS. Results showed 84.6% of the Hb Adana patients were Malays. Using DNA studies, compound heterozygosity for Hb Adana and HbCS (α(codon 59)α/α(CS)α) was confirmed in 11 patients. A novel point in this investigation was that DNA studies confirmed Hb Paksé for the first time in a Malaysian patient (α(codon 59)α/α(Paksé)α) after nine years of being misdiagnosis with Hb Adana and HbCS (α(codon 59)α/α(CS)α). Thus, the reliance on haematology studies and Hb subtyping to detect Hb variants is inadequate in countries where thalassaemia is prevalent and caused by a wide spectrum of mutations.
  6. Tan JA, Tan KL, Omar KZ, Chan LL, Wee YC, George E
    Eur J Pediatr, 2009 Sep;168(9):1049-54.
    PMID: 19034506 DOI: 10.1007/s00431-008-0877-9
    INTRODUCTION: Interactions of different hemoglobin variants with thalassemia alleles can result in various clinical phenotypes. HbE-beta-thalassemia generally manifests with severe anemia where individuals exhibit beta-thalassemia major with regular blood transfusions or beta-thalassemia intermedia with periodic blood transfusions. This study presents a unique Malay family with three beta-globin gene defects-HbE, Hb South Florida, and IVS1-1 (G-->A).

    MATERIALS AND METHODS: HbE activates a cryptic splice site that produces non-functional mRNAs. Hb South Florida is a rare beta-hemoglobin variant, and its interactions with other beta-thalassemia alleles have not been reported. IVS1-1 is a Mediterranean mutation that affects mRNA processing giving rise to beta(o)-thalassemia.

    RESULTS AND DISCUSSION: Fifteen mutations along the beta-globin gene complex were analyzed using the amplification refractory mutation system. Hb South Florida was identified by direct sequencing using genomic DNA.

    CONCLUSION: The affected child with HbE/IVS1-1 produced a beta-thalassemia major phenotype. Compound heterozygosity for Hb South Florida/IVS1-1 produced a beta-thalassemia carrier phenotype in the mother.

  7. Tan JA, Chin PS, Wong YC, Tan KL, Chan LL, George E
    Pathology, 2006 Oct;38(5):437-41.
    PMID: 17008283
    In Malaysia, about 4.5% of the Malay and Chinese populations are heterozygous carriers of beta-thalassaemia. The initial identification of rare beta-globin gene mutations by genomic sequencing will allow the development of simpler and cost-effective PCR-based techniques to complement the existing amplification refractory mutation system (ARMS) and gap-PCR used for the identification of beta-thalassaemia mutations.
  8. Samsudin IN, Md Saleh R, Thambiah SC, Mohamad Amir Hamzah AS, Wan Khalik WNF, George E
    MyJurnal
    Background: Diabetic retinopathy (DR) is a microvascular complication of diabetes, which is a cause of visual impairment and blindness. Its development and progression have been linked to dyslipidaemia, although the link remains inconclusive.
    Aim: This study aimed to determine the prevalence of dyslipidaemia among type 2 diabetic patients with DR in a tertiary setting and to determine the association between dyslipidaemia and DR severity.
    Materials and methods: This was a cross sectional study using retrospective data of type 2 diabetic patients attending the opthalmology clinic of a tertiary centre from January 2007 to June 2014. Results of their fasting lipid profile and clinical data were retrieved from the hospital information system.
    Results: A total of 178 patient’s data were collected. 120 (n=67.4%) patients had non-proliferative diabetic retinopathy (NDPR) with moderate NPDR being the most prevalent. Dyslipidaemia was noted in 151 (84.8%) of the patients. Patients had a combination of more than one abnormality in the lipid profile with increased LDL-cholesterol being the main abnormality. Dyslipidaemia was however, not significantly associated with DR severity.
    Conclusion: Dyslipidaemia was highly prevalent in DR patients. The dyslipidaemia was however not associated with severity of DR.
    Study site: Ophthalmology clinic, Hospital (?name), Malaysia
  9. George E
    Family Practitioner, 1988;11(1):7-10.
  10. Tan JA, Kok JL, Tan KL, Wee YC, George E
    Genes Genet Syst, 2009 Feb;84(1):67-71.
    PMID: 19420802
    Co-inheritance of alpha-thalassemia with homozygosity or compound heterozygosity for beta-thalassemia may ameliorate beta-thalassemia major. A wide range of clinical phenotypes is produced depending on the number of alpha-thalassemia alleles (-alpha/alphaalpha --/alphaalpha, --/-alpha). The co-inheritance of beta-thalassemia with alpha-thalassemia with a single gene deletion (-alpha/alphaalpha) is usually associated with thalassemia major. In contrast, the co-inheritance of beta-thalassemia with two alpha-genes deleted in cis or trans (--/alphaalpha or -alpha/-alpha) generally produces beta-thalassemia intermedia. In Southeast Asia, the most common defect responsible for alpha-thalassemia is the Southeast Asian (SEA) deletion of 20.5 kilobases. The presence of the SEA deletion with Hb Constant Spring (HbCS) produces HbH-CS disease. Co-inheritance of HbH-CS with compound heterozygosity for beta-thalassemia is very rare. This study presents a Malay patient with HbH-CS disorder and beta degrees/beta+-thalassemia. The SEA deletion was confirmed in the patient using a duplex-PCR. A Combine-Amplification Refractory Mutation System (C-ARMS) technique to simultaneously detect HbCS and Hb Quong Sze confirmed HbCS in the patient. Compound heterozygosity for CD41/42 and Poly A was confirmed using the ARMS. This is a unique case as the SEA alpha-gene deletion in cis (--SEA/alphaalpha) is generally not present in the Malays, who more commonly possess the two alpha-gene deletion in trans (-alpha/-alpha). In addition, the beta-globin gene mutation at CD41/42 is a common mutation in the Chinese and not in the Malays. The presence of both the SEA deletion and CD41/42 in the mother of the patient suggests the possible introduction of these two defects into the family by marriage with a Chinese.
  11. Intan Nureslyna Samsudin, Thambiah, Subashini C., Wan Mohamad Asyraf Wan Mohammed Ayub, Cheng, Ng Wan, Zanariah Hussein, Nurain Mohd Noor, et al.
    MyJurnal
    The glycosylated haemoglobin (HbA1c) test is the most widely accepted laboratory test for evaluating long term glycaemic control. Patient’s understanding of HbA1c can lead to better glycaemic control. This study is aimed to determine the awareness and level of understanding of HbA1c among type 2 DM patients and its association with glycaemic control. A cross-sectional descriptive study among Type 2 DM patients undergoing routine follow up in an endocrine clinic of a tertiary centre in Malaysia. Patients were invited to answer a validated questionnaire which assessed their awareness and understanding of HbA1c. Their last HbA1c results were retrieved from the laboratory information system. A total of 92 participants were recruited. Fifty-six (60.9%) were aware of the term HbA1c. Fifty percent were categorised as having good HbA1c understanding, with age, monthly income and level of education being the factors associated with understanding. No significant association was noted between HbA1c understanding and glycaemic control, although more patients with good HbA1c understanding had achieved the target glycaemic control compared to those with poor understanding. The level of HbA1c awareness and understanding was acceptable. Factors associated with understanding were age, income and level of education. Continuing efforts however, must be made to improve patients understanding of their disease and clinical disease biomarkers.
  12. Teh LK, George E, Lai MI, Tan JA, Wong L, Ismail P
    J Hum Genet, 2014 Mar;59(3):119-23.
    PMID: 24369358 DOI: 10.1038/jhg.2013.131
    Beta-thalassemia is one of the most prevalent inherited diseases and a public health problem in Malaysia. Malaysia is geographically divided into West and East Malaysia. In Sabah, a state in East Malaysia, there are over 1000 estimated cases of β-thalassemia major patients. Accurate population frequency data of the molecular basis of β-thalassemia major are needed for planning its control in the high-risk population of Sabah. Characterization of β-globin gene defects was done in 252 transfusion dependent β-thalassemia patients incorporating few PCR techniques. The study demonstrates that β-thalassemia mutations inherited are ethnically dependent. It is important to note that 86.9% of transfusion-dependent β-thalassemia major patients in Sabah were of the indigenous population and homozygous for a single mutation. The Filipino β(0)-deletion was a unique mutation found in the indigenous population of Sabah. Mutations common in West Malaysia were found in 11 (4.3%) patients. Four rare mutations (Hb Monroe, CD 8/9, CD 123/124/125 and IVS I-2) were also found. This study is informative on the population genetics of β-thalassemia major in Sabah.
  13. Lim WF, Muniandi L, George E, Sathar J, Teh LK, Gan GG, et al.
    Blood Cells Mol. Dis., 2012 Jan 15;48(1):17-21.
    PMID: 22079025 DOI: 10.1016/j.bcmd.2011.10.002
    The alpha haemoglobin stabilising protein (AHSP) acts as a molecular chaperone for α-globin by stabilising nascent α-globin before transferring it to waiting free β-globin chains. Binding of AHSP to α-globin renders α-globin chemically inert whereby preventing it from precipitating and forming reactive oxygen species byproducts. The AHSP has been actively studied in the recent years, particularly in its relation to β-thalassaemia. Studies have shown that AHSP is a modifier in β-thalassaemia mice models. However, this relationship is less established in humans. Studies by some groups showed no correlation between the AHSP haplotypes and the severity of β-thalassaemia, whereas others have shown that certain AHSP haplotype could modify the phenotype of β-thalassaemia intermedia patients. We investigated the expression of AHSP in relation to selected demographic data, full blood count, HPLC results, HbE/β-thalassaemia genotype, Xmn-1 Gγ polymorphism, α-globin, β-globin and γ-globin expression. We found that AHSP expression was significantly correlated to mean cell haemoglobin level, HbF %, α-globin, β-globin and excess α-globin expression. We concluded that AHSP could be a secondary compensatory mechanism in red blood cells to counterbalance the excess α-globin chains in HbE/β-thalassaemia individuals.
  14. Lee TY, Muniandy L, Teh LK, Abdullah M, George E, Sathar J, et al.
    Turk J Haematol, 2016 Mar 05;33(1):15-20.
    PMID: 26377036 DOI: 10.4274/tjh.2014.0197
    The diverse clinical phenotype of hemoglobin E (HbE)/β-thalassemia has not only confounded clinicians in matters of patient management but has also led scientists to investigate the complex mechanisms involved in maintaining the delicate red cell environment where, even with apparent similarities of α- and β-globin genotypes, the phenotype tells a different story. The BTB and CNC homology 1 (BACH1) protein is known to regulate α- and β-globin gene transcriptions during the terminal differentiation of erythroid cells. With the mutations involved in HbE/β-thalassemia disorder, we studied the role of BACH1 in compensating for the globin chain imbalance, albeit for fine-tuning purposes.
  15. Lim, Wai Feng, Muniandi, Logeswaran, George, Elizabeth, Sathar, Jameela, Teh, Lai Kuan, Lai, Mei I.
    MyJurnal
    HbE/β-thalassaemia is a compound heterozygous mutation with a vast clinical phenotype [1]. To improve quality of life, HbE/β-thalassaemia individuals receive different treatment strategies, either individually or in combination with therapy(ies), including blood transfusion, iron chelation and splenectomy [2-3]. Thus far, there are limited studies conducted regarding the effect of treatments in HbE/β-thalassaemia individuals. We hereby investigated the effect of treatments with respect to red blood cell indices, haemoglobin subtypes and gene expressions among 30 HbE/beta-thalassaemia individuals. Statistical analyses were carried out using SPSS 17.0. As compared to single therapy (transfused only individuals) and double therapies (transfused-chelated only individuals), individuals receiving triple therapies (transfused-chelated-splenectomised individuals) showed significantly high mean cell volume (MCV), mean cell haemoglobin (MCH) and reticulocytes count (Fig.1).

    These findings suggest that triple therapies are the most effective in ameliorating the severity of the disease in terms of microcytosis and hypochromia [3-5]. The high reticulocyte count in triple therapies also allows the bone marrow to actively produce red blood cells suggesting that these therapies have clinical benefits by suppressing the ineffective erythropoiesis and improving the erythropoietic environment significantly among HbE/β-thalassaemia individuals in our studied group [6-7].

    The effectiveness of these treatments is different among each HbE/β-thalassaemia individual whereby clinical variabilities among them could be a contributing factor. Triple therapies giving the best advantage to the HbE/β-thalassaemia patient in this study.
  16. George E, Lai MI, Teh LK, Ramasamy R, Goh EH, Asokan K, et al.
    Med J Malaysia, 2011 Dec;66(5):429-34.
    PMID: 22390095 MyJurnal
    Detection and quantification of Hb subtypes of human blood is integral to presumptive identification of thalassaemias. It has been used in neonatal screening of thalassaemia and Hb variants. The use of discarded red blood cells following processing of the cord blood for stem cells provides readily available diagnostic material for thalassaemia screening. In this study, we determined the range of Hb subtypes in 195 consecutive cord blood samples collected for cord blood banking. The 'cord blood samples' analysed were those of the remaining red blood cells after the cord blood was processed for stem cell storage. Quantification of Hb subtypes by high performance liquid chromatography (HPLC) was done on BioRad Variant II Hb testing system. Only 73 (36.5%) of the samples could be analyzed neat without dilution. With a 1:300 dilution with wash solution the acceptable area as recommended by the manufacturer for reading of a C-gram within the 1 to 3 million ranges were achieved in all. Eighteen (9%) 12 showed classical Hb Barts (y4) prerun peaks were confirmed by Sebia Hydrasys automated Hb gel electrophoresis and quantified by Sebia Capillarys 2 capillary electrophoresis. Only 1 (0.5%) was presumptively identified with HbH disease. Due to the limited number of samples no beta-thalassaemia major, Hb E beta-thalassaemia and Hb Barts hydrops fetalis were found. The HPLC assay was possible at a cost US$ 5 per sample and a turnover time of 10 samples per hour without technical difficulties. This study reports an effective and valuable protocol for thalassaemia screening in red blood cells which would otherwise be discarded during cord blood processing. Cord blood with severe and intermediate forms of thalassaemia can be preselected and not stored.
  17. Thambiah CS, Samsudin IN, George E, Ranjit LK, Saat NS, Hussein Z, et al.
    MyJurnal
    Patients with diabetes have an earlier onset and increased severity of anaemia compared to those with similar degree of renal impairment from other causes. Anaemia is associated with an increased risk of vascular complications. In this study, we determined the prevalence of anaemia in T2DM patients and its association with sociodemographic, clinical and laboratory parameters in an endocrine tertiary hospital in Malaysia. This was a cross-sectional study using retrospective electronic data from January 2011 to December 2013 of 165 T2DM patients in Hospital Putrajaya. Data was analysed using IBM SPSS Statistics version 21.0 for Windows. The prevalence of anaemia was 39.4% and majority had normocytic normochromic (80%), mild (58.5%) anaemia. Majority were Malays (73.9%), aged below 60 with comparable gender percentage and long-standing, poorly-controlled DM [median fasting blood sugar (FBS) 8mmol/L; glycated haemoglobin (HbA1c) 7.9%]. Using the KDIGO chronic kidney disease (CKD) staging system, 86% of these patients were in stages 3-5. Anaemic patients had a significantly higher serum urea, creatinine and a lower FBS, estimated glomerular filtration rate (eGFR) compared to non-anaemic patients. Anaemic patients with diabetic nephropathy had a significantly lower haemoglobin (Hb) compared to those without this complication (p=0.022). The sensitivity and specificity at a cut-off eGFR value of 38.3 ml/min/1.73 m2 (maximum Youden index = 0.462) was 66.7% and 79.5%, respectively to discriminate mild from moderate anaemia. This study shows that anaemia is already present in T2DM patients in Hospital Putrajaya at initial presentation to the specialist outpatient clinic and is significantly associated with CKD. Hence, it emphasises the obligatory need for routine and follow-up full blood count monitoring in T2DM patients in primary care as well as tertiary settings in Malaysia to enable early detection and aggressive correction of anaemia in preventing further complications.

    Study site: endocrine clinic, Hospital Putrajaya
  18. Pasangna J, George E, Nagaratnam M
    Malays J Pathol, 2005 Jun;27(1):33-7.
    PMID: 16676691
    A 2-year-old Malay boy was brought to the University Malaya Medical Centre for thalassaemia screening. Physical examination revealed thalassaemia facies, pallor, mild jaundice, hepatomegaly and splenomegaly. Laboratory investigations on the patient including studies on the parents lead to a presumptive diagnosis of homozygous Haemoglobin Lepore (Hb Lepore). The aim of this paper is to increase awareness of this rare disorder, this being the first case documented in Malaysia in a Malay. The case also demonstrates the need for this disorder to be included in the differential diagnosis of patients presenting clinically like thalassemia intermedia or thalassemia major. Accurate diagnosis would provide information necessary for prenatal diagnosis, proper clinical management and genetic counseling. The clinical, haematological and laboratory features of this disorder are discussed in this paper.
  19. Riahi S, Mei IL, Idris FB, George E, Noor SM
    PMID: 26863862
    Pre-donation screening declarations and hemoglobin (Hb) testing are measures used to determine the quality of donated blood. The copper sulphate (CuSo4) method used to screen for blood abnormalities can give inaccurate results if strict quality control is not applied. Blood donors who are carriers of thalassemia and those with mild iron deficiency anemia (IDA) are usually asymptomatic and frequently missed at blood donation. The aim of this study was to evaluate the red blood cell (RBC) indices related disorders among blood donors who were deemed qualified to donate blood after screening with CuSo4 method. One hundred fifty-eight volunteer blood donors at the Universiti Putra Malaysia (UPM), who had passed the CuSo4 screening method, were recruited for this study. Their bloods specimens were examined with a complete blood count. Subjects with a low mean corpuscular hemoglobin (MCH) level were examined further by checking a serum ferritin level, Hb quantification, and molecular analysis to examine for common RBC disorders. Fourteen point six percent of subjects had a low Hb level, two (1.3%) had IDA and four (2.5%) had thalassemia or some other hemoglobinopathy. Using a MCH level < 27 pg as a cut-off point, 58 subjects (36.7%) had suspected IDA, thalassemia or some other hemoglobinopathy. Eight point nine percent of subjects with a normal Hb level had thalassemia, and 3.8% had IDA. Malaysia has a high prevalence of thalassemia and other hemoglobinopathies. Pre-donation accurate screening is crucial to protect the quality of blood transfusion products. Public education regarding RBC disorders especially among blood donors is important.
  20. Lee, Tze Yan, George, Elizabeth, Mei, I Lai, Ramachandran, Vasudevan, Tan, Jin Ai Mary Anne, Lai, Kuan Teh, et al.
    MyJurnal
    Globally, α-thalassaemia is a highly prevalent disease. In Malaysia, this disorder is a well-known public health problem [1]. The three most common deletional α-thalassaemia found in this region include --SEA deletion, -α3.7 and -α4.2 deletions [2]. The prevalence rate of triplication alpha cases such as αααanti3.7 and αααanti4.2 is unknown in Malaysia although it plays a pivotal role in exacerbating the clinical phenotypes in beta thalassaemia carriers [3]. Therefore, the purpose of this study was to design an assay for the detection of triplications and common deletional alpha thalassaemia using droplet digital PCR (ddPCR). Copy number changes were analysed using Quanta-SoftTM software version 1.6.6 after performing ddPCR. Sensitivity and validation analysis were also performed on the DNA samples. The changes in copy number changes (common deletions, duplications and triplications) in the alpha globin gene has been quantitatively detected using ddPCR. For the samples validation as determined by ddPCR, the mean copy number values for αα/αα are 2.0275±0.0177 (HS-40), 1.8175±0.0389 (HBA2), 2.0450±0.0848 (HB 3.7), 2.0050±0.0000 (HBA1). For -α3.7 /--SEA, the mean copy number values are 2.0225±0.2180 (HS-40), 0.9325±0.1213 (HBA2), 0 (HB 3.7), 0.9984±0.1333 (HBA1). As for –α4.2 /--SEA, the mean copy number values are 1.9350 (HS-40), 0 (HBA2), 0.7945 (HB 3.7), 0.8480 (HBA1). The mean copy number values for --SEA/αα samples are 1.9067±0.1327 (HS-40), 0.8164±0.0364 (HBA2), 0.8920±0.0434 (HB 3.7), 0.9148±0.0338 (HBA1) respectively. This study has found that the use of ddPCR is convenient as it allows direct quantification without the requirement of a calibration curve unlike qPCR [4]. Secondly, this study also showed that ddPCR is accurate and precise in the detection of alpha thalassaemia deletions and triplications based on the gene dosages using absolute quantification. In addition, the non-requirement of post-PCR work has minimised the risk of PCR carryover contamination. Thirdly, ddPCR saves time with less turnaround time and minimise the labour work required as compared to techniques such as MLPA which requires DNA denaturation and hybridisation reaction on day 1 while ligation and PCR reaction on day 2. Fourthly, this study found that the detection of α-thalassaemia using ddPCR is sensitive. DNA samples with low concentration as low as 1 ng were able to be detected for α-thalassaemia using ddPCR. The ability to detect minute amount of DNA concentration is crucial particularly in the diagnosing of the lethal HbH hydrops foetalis during the neonatal stage in α-thalassaemia. In conclusion, this is an alternative method (ddPCR) that can be employed for rapid detection of alpha thalassaemia variants in Malaysia.
Filters
Contact Us

Please provide feedback to Administrator (afdal@afpm.org.my)

External Links