MyMedR

Displaying publications 21 - 34 of 34 in total

Abstract:

Sort:

Fulltext Correlation of BACH1 and Hemoglobin E/Beta-Thalassemia Globin Expression

Lee TY, Muniandy L, Teh LK, Abdullah M, George E, Sathar J, et al.

Turk J Haematol, 2016 Mar 05;33(1):15-20.
PMID: 26377036 DOI: 10.4274/tjh.2014.0197

The diverse clinical phenotype of hemoglobin E (HbE)/β-thalassemia has not only confounded clinicians in matters of patient management but has also led scientists to investigate the complex mechanisms involved in maintaining the delicate red cell environment where, even with apparent similarities of α- and β-globin genotypes, the phenotype tells a different story. The BTB and CNC homology 1 (BACH1) protein is known to regulate α- and β-globin gene transcriptions during the terminal differentiation of erythroid cells. With the mutations involved in HbE/β-thalassemia disorder, we studied the role of BACH1 in compensating for the globin chain imbalance, albeit for fine-tuning purposes.
Fulltext DNA studies are necessary for accurate patient diagnosis in compound heterozygosity for Hb Adana (HBA2:c.179>A) with deletional or nondeletional α-thalassaemia

Tan JA, Kho SL, Ngim CF, Chua KH, Goh AS, Yeoh SL, et al.

Sci Rep, 2016 06 08;6:26994.
PMID: 27271331 DOI: 10.1038/srep26994

Haemoglobin (Hb) Adana (HBA2:c.179>A) interacts with deletional and nondeletional α-thalassaemia mutations to produce HbH disorders with varying clinical manifestations from asymptomatic to severe anaemia with significant hepatosplenomegaly. Hb Adana carriers are generally asymptomatic and haemoglobin subtyping is unable to detect this highly unstable α-haemoglobin variant. This study identified 13 patients with compound heterozygosity for Hb Adana with either the 3.7 kb gene deletion (-α(3.7)), Hb Constant Spring (HbCS) (HBA2:c.427T>C) or Hb Paksé (HBA2:429A>T). Multiplex Amplification Refractory Mutation System was used for the detection of five deletional and six nondeletional α-thalassaemia mutations. Duplex-PCR was used to confirm Hb Paksé and HbCS. Results showed 84.6% of the Hb Adana patients were Malays. Using DNA studies, compound heterozygosity for Hb Adana and HbCS (α(codon 59)α/α(CS)α) was confirmed in 11 patients. A novel point in this investigation was that DNA studies confirmed Hb Paksé for the first time in a Malaysian patient (α(codon 59)α/α(Paksé)α) after nine years of being misdiagnosis with Hb Adana and HbCS (α(codon 59)α/α(CS)α). Thus, the reliance on haematology studies and Hb subtyping to detect Hb variants is inadequate in countries where thalassaemia is prevalent and caused by a wide spectrum of mutations.
Fulltext Evaluation of red blood cell indices related disorders among eligible blood donors at the Universiti Putra Malaysia (UPM)

Riahi S, Mei IL, Idris FB, George E, Noor SM

Southeast Asian J. Trop. Med. Public Health, 2015 Sep;46(5):911-7.
PMID: 26863862

Pre-donation screening declarations and hemoglobin (Hb) testing are measures used to determine the quality of donated blood. The copper sulphate (CuSo4) method used to screen for blood abnormalities can give inaccurate results if strict quality control is not applied. Blood donors who are carriers of thalassemia and those with mild iron deficiency anemia (IDA) are usually asymptomatic and frequently missed at blood donation. The aim of this study was to evaluate the red blood cell (RBC) indices related disorders among blood donors who were deemed qualified to donate blood after screening with CuSo4 method. One hundred fifty-eight volunteer blood donors at the Universiti Putra Malaysia (UPM), who had passed the CuSo4 screening method, were recruited for this study. Their bloods specimens were examined with a complete blood count. Subjects with a low mean corpuscular hemoglobin (MCH) level were examined further by checking a serum ferritin level, Hb quantification, and molecular analysis to examine for common RBC disorders. Fourteen point six percent of subjects had a low Hb level, two (1.3%) had IDA and four (2.5%) had thalassemia or some other hemoglobinopathy. Using a MCH level < 27 pg as a cut-off point, 58 subjects (36.7%) had suspected IDA, thalassemia or some other hemoglobinopathy. Eight point nine percent of subjects with a normal Hb level had thalassemia, and 3.8% had IDA. Malaysia has a high prevalence of thalassemia and other hemoglobinopathies. Pre-donation accurate screening is crucial to protect the quality of blood transfusion products. Public education regarding RBC disorders especially among blood donors is important.
Interaction of Hb South Florida (codon 1; GTG-->ATG) and HbE, with beta-thalassemia (IVS1-1; G-->A): expression of different clinical phenotypes

Tan JA, Tan KL, Omar KZ, Chan LL, Wee YC, George E

Eur J Pediatr, 2009 Sep;168(9):1049-54.
PMID: 19034506 DOI: 10.1007/s00431-008-0877-9

INTRODUCTION: Interactions of different hemoglobin variants with thalassemia alleles can result in various clinical phenotypes. HbE-beta-thalassemia generally manifests with severe anemia where individuals exhibit beta-thalassemia major with regular blood transfusions or beta-thalassemia intermedia with periodic blood transfusions. This study presents a unique Malay family with three beta-globin gene defects-HbE, Hb South Florida, and IVS1-1 (G-->A).
MATERIALS AND METHODS: HbE activates a cryptic splice site that produces non-functional mRNAs. Hb South Florida is a rare beta-hemoglobin variant, and its interactions with other beta-thalassemia alleles have not been reported. IVS1-1 is a Mediterranean mutation that affects mRNA processing giving rise to beta(o)-thalassemia.
RESULTS AND DISCUSSION: Fifteen mutations along the beta-globin gene complex were analyzed using the amplification refractory mutation system. Hb South Florida was identified by direct sequencing using genomic DNA.
CONCLUSION: The affected child with HbE/IVS1-1 produced a beta-thalassemia major phenotype. Compound heterozygosity for Hb South Florida/IVS1-1 produced a beta-thalassemia carrier phenotype in the mother.
Characterisation and confirmation of rare beta-thalassaemia mutations in the Malay, Chinese and Indian ethnic groups in Malaysia

Tan JA, Chin PS, Wong YC, Tan KL, Chan LL, George E

Pathology, 2006 Oct;38(5):437-41.
PMID: 17008283

In Malaysia, about 4.5% of the Malay and Chinese populations are heterozygous carriers of beta-thalassaemia. The initial identification of rare beta-globin gene mutations by genomic sequencing will allow the development of simpler and cost-effective PCR-based techniques to complement the existing amplification refractory mutation system (ARMS) and gap-PCR used for the identification of beta-thalassaemia mutations.
Mesenchymal stem cells of human placenta and umbilical cord suppress T-cell proliferation at G0 phase of cell cycle

Vellasamy S, Sandrasaigaran P, Vidyadaran S, Abdullah M, George E, Ramasamy R

Cell Biol Int, 2013 Mar;37(3):250-6.
PMID: 23364902 DOI: 10.1002/cbin.10033

Mesenchymal stem cells (MSC) generated from human umbilical cord (UC-MSC) and placenta (PLC-MSC) were assessed and compared for their immunomodulatory function on T cells proliferation by analysis of the cell cycle. Mitogen stimulated or resting T cells were co-cultured in the presence or absence of MSC. T-cell proliferation was assessed by tritiated thymidine ((3) H-TdR) assay and the mechanism of inhibition was examined bycell cycle and apoptosis assay. Both UC-MSC and PLC-MSC profoundly inhibited the proliferation of T-cell, mainly via cell-to-cell contact. MSC-mediated anti-proliferation does not lead to apoptosis,but prevented T cells from entering S phase and they therefore accumulated in the G(0) /G(1) phases. The anti-proliferative activity of MSC was related to this cell cycle arrest of T-cell. UC-MSC produced a greater inhibition than PLC-MSC in all measured parameters.
Fulltext Prevalence of dyslipidaemia in type 2 diabetes mellitus patients and Its association to diabetic retinopathy in a Malaysian tertiary hospital

Samsudin IN, Md Saleh R, Thambiah SC, Mohamad Amir Hamzah AS, Wan Khalik WNF, George E

Malaysian Journal of Medicine and Health Sciences, 2014;10(2):47-51.
MyJurnal

Background: Diabetic retinopathy (DR) is a microvascular complication of diabetes, which is a cause of visual impairment and blindness. Its development and progression have been linked to dyslipidaemia, although the link remains inconclusive.
Aim: This study aimed to determine the prevalence of dyslipidaemia among type 2 diabetic patients with DR in a tertiary setting and to determine the association between dyslipidaemia and DR severity.
Materials and methods: This was a cross sectional study using retrospective data of type 2 diabetic patients attending the opthalmology clinic of a tertiary centre from January 2007 to June 2014. Results of their fasting lipid profile and clinical data were retrieved from the hospital information system.
Results: A total of 178 patient’s data were collected. 120 (n=67.4%) patients had non-proliferative diabetic retinopathy (NDPR) with moderate NPDR being the most prevalent. Dyslipidaemia was noted in 151 (84.8%) of the patients. Patients had a combination of more than one abnormality in the lipid profile with increased LDL-cholesterol being the main abnormality. Dyslipidaemia was however, not significantly associated with DR severity.
Conclusion: Dyslipidaemia was highly prevalent in DR patients. The dyslipidaemia was however not associated with severity of DR.
Study site: Ophthalmology clinic, Hospital (?name), Malaysia
Fulltext Pre-transplantation serum ferritin as a prognostic marker in allogeneic haemopoietic stem cell transplant patients in a tertiary care hospital in Malaysia

Thambiah SC, George E, Samsudin IN, Hong LH, Chuo LL, Ramli N, et al.

Natl Med J India, 2016 May-Jun;29(3):136-140.
PMID: 27808061

BACKGROUND: The principal cause of iron overload in patients with haematological malignancies is recurrent red cell transfusions for anaemia. The serum ferritin level reflects the iron burden in the body, in the absence of inflammation or liver disease. In Malaysia, data are lacking on the association between pre-transplant serum ferritin levels and outcome after allogeneic haemopoietic stem cell transplant.

METHODS: We did a cross-sectional study using retrospective data of 106 post-allogeneic haemopoietic stem cell transplant patients (HLA-matched sibling) with haematological malignancies at Hospital Ampang to determine the relationship between pre-transplant serum ferritin levels and post-transplant outcome, post-transplant complications and survival time. Patients were divided into two groups according to the iron status: serum ferritin level >1000 μg/L (iron overload) and <1000 μg/L.

RESULTS: The median age for patients was 30.5 (18-58) years. The median pre-transplantation serum ferritin level and the prevalence of pre-transplantation iron overload were 2423 (408.2-7664) μg/L and 87.5%, respectively. No significant association was found between iron status and demographic factors, type of haematological malignancy and post-transplant complications. Although insignificant, patients with iron overload had a shorter survival time (36 months) compared to those with no iron overload (40 months). There was also no significant association between the iron status and post-transplant outcome. Significant post-transplant complications associated with post-transplant outcome were the need for total parenteral nutrition (TPN) (p=0.014) and chronic graft-versus-host disease (GVHD) (p=0.008). Similarly, significant associations were found between age group (p=0.003), TPN (p=0.035) and chronic GVHD (p=0.012) with survival time using Kaplan-Meir analysis. However, after Cox regression, only age group was found to be significantly associated with survival time (p=0.014).

CONCLUSION: Serum ferritin is an acute phase reactant and its levels increase in the presence of tissue necrosis and inflammation. Both these events occur in haematological malignancies. Although serum ferritin level is a non-invasive, relatively cost-effective, widely available and practical indicator of iron status, it is not specific to iron overload. Therefore, a true association between the serum ferritin level and iron burden is problematic in patients with haematological malignancies.
Thalassemia intermedia in HbH-CS disease with compound heterozygosity for beta-thalassemia: challenges in hemoglobin analysis and clinical diagnosis

Tan JA, Kok JL, Tan KL, Wee YC, George E

Genes Genet Syst, 2009 Feb;84(1):67-71.
PMID: 19420802

Co-inheritance of alpha-thalassemia with homozygosity or compound heterozygosity for beta-thalassemia may ameliorate beta-thalassemia major. A wide range of clinical phenotypes is produced depending on the number of alpha-thalassemia alleles (-alpha/alphaalpha --/alphaalpha, --/-alpha). The co-inheritance of beta-thalassemia with alpha-thalassemia with a single gene deletion (-alpha/alphaalpha) is usually associated with thalassemia major. In contrast, the co-inheritance of beta-thalassemia with two alpha-genes deleted in cis or trans (--/alphaalpha or -alpha/-alpha) generally produces beta-thalassemia intermedia. In Southeast Asia, the most common defect responsible for alpha-thalassemia is the Southeast Asian (SEA) deletion of 20.5 kilobases. The presence of the SEA deletion with Hb Constant Spring (HbCS) produces HbH-CS disease. Co-inheritance of HbH-CS with compound heterozygosity for beta-thalassemia is very rare. This study presents a Malay patient with HbH-CS disorder and beta degrees/beta+-thalassemia. The SEA deletion was confirmed in the patient using a duplex-PCR. A Combine-Amplification Refractory Mutation System (C-ARMS) technique to simultaneously detect HbCS and Hb Quong Sze confirmed HbCS in the patient. Compound heterozygosity for CD41/42 and Poly A was confirmed using the ARMS. This is a unique case as the SEA alpha-gene deletion in cis (--SEA/alphaalpha) is generally not present in the Malays, who more commonly possess the two alpha-gene deletion in trans (-alpha/-alpha). In addition, the beta-globin gene mutation at CD41/42 is a common mutation in the Chinese and not in the Malays. The presence of both the SEA deletion and CD41/42 in the mother of the patient suggests the possible introduction of these two defects into the family by marriage with a Chinese.
Fulltext High prevalence of alpha- and beta-thalassemia in the Kadazandusuns in East Malaysia: challenges in providing effective health care for an indigenous group

Tan JA, Lee PC, Wee YC, Tan KL, Mahali NF, George E, et al.

J Biomed Biotechnol, 2010;2010.
PMID: 20871816 DOI: 10.1155/2010/706872

Thalassemia can lead to severe transfusion-dependent anemia, and it is the most common genetic disorder in Malaysia. This paper aims to determine the prevalence of thalassemia in the Kadazandusuns, the largest indigenous group in Sabah, East Malaysia. α- and β-thalassemia were confirmed in 33.6% and 12.8%, of the individuals studied respectively. The high prevalence of α- and β-thalassemia in the Kadazandusuns indicates that thalassemia screening, genetic counseling, and prenatal diagnosis should be included as part of their healthcare system. This preliminary paper serves as a baseline for further investigations into the health and genetic defects of the major indigenous population in Sabah, East Malaysia.
Fulltext Molecular characterisation of Haemoglobin Constant Spring and Haemoglobin Quong Sze with a Combine-Amplification Refractory Mutation System

Wee YC, Tan KL, Chua KH, George E, Tan JA

Malays J Med Sci, 2009 Jul;16(3):21-8.
PMID: 22589661 MyJurnal

BACKGROUND: The interaction of the non-deletional α(+)-thalassaemia mutations Haemoglobin Constant Spring and Haemoglobin Quong Sze with the Southeast Asian double α-globin gene deletion results in non-deletional Haemoglobin H disease. Accurate detection of non-deletional Haemoglobin H disease, which is associated with severe phenotypes, is necessary as these mutations have been confirmed in the Malaysian population.
METHODS: DNA from two families with Haemoglobin H disease was extracted from EDTA-anticoagulated whole blood and subjected to molecular analysis for α-thalassaemia. A duplex polymerase chain reaction was used to detect the Southeast Asian α-globin gene deletion. Polymerase chain reaction-restriction fragment length polymorphism analysis was then carried out to determine the presence of Haemoglobin Constant Spring and Haemoglobin Quong Sze. A combine-amplification refractory mutation system protocol was optimised and implemented for the rapid and specific molecular characterisation of Haemoglobin Constant Spring and Haemoglobin Quong Sze in a single polymerase chain reaction.
RESULTS AND CONCLUSIONS: The combine-amplification refractory mutation system for Haemoglobin Constant Spring and Haemoglobin Quong Sze, together with the duplex polymerase chain reaction, provides accurate pre- and postnatal diagnosis of non-deletional Haemoglobin H disease and allows detailed genotype analyses using minimal quantities of DNA.
KEYWORDS: Combine-ARMS; Hb Constant Spring; Hb Quong Sze; medical sciences
Fulltext Screening for intermediate and severe forms of thalassaemia in discarded red blood cells: optimization and feasibility

George E, Lai MI, Teh LK, Ramasamy R, Goh EH, Asokan K, et al.

Med J Malaysia, 2011 Dec;66(5):429-34.
PMID: 22390095 MyJurnal

Detection and quantification of Hb subtypes of human blood is integral to presumptive identification of thalassaemias. It has been used in neonatal screening of thalassaemia and Hb variants. The use of discarded red blood cells following processing of the cord blood for stem cells provides readily available diagnostic material for thalassaemia screening. In this study, we determined the range of Hb subtypes in 195 consecutive cord blood samples collected for cord blood banking. The 'cord blood samples' analysed were those of the remaining red blood cells after the cord blood was processed for stem cell storage. Quantification of Hb subtypes by high performance liquid chromatography (HPLC) was done on BioRad Variant II Hb testing system. Only 73 (36.5%) of the samples could be analyzed neat without dilution. With a 1:300 dilution with wash solution the acceptable area as recommended by the manufacturer for reading of a C-gram within the 1 to 3 million ranges were achieved in all. Eighteen (9%) 12 showed classical Hb Barts (y4) prerun peaks were confirmed by Sebia Hydrasys automated Hb gel electrophoresis and quantified by Sebia Capillarys 2 capillary electrophoresis. Only 1 (0.5%) was presumptively identified with HbH disease. Due to the limited number of samples no beta-thalassaemia major, Hb E beta-thalassaemia and Hb Barts hydrops fetalis were found. The HPLC assay was possible at a cost US$ 5 per sample and a turnover time of 10 samples per hour without technical difficulties. This study reports an effective and valuable protocol for thalassaemia screening in red blood cells which would otherwise be discarded during cord blood processing. Cord blood with severe and intermediate forms of thalassaemia can be preselected and not stored.
Fulltext Anaemia in type 2 diabetes mellitus (T2DM) patients in Hospital Putrajaya

Thambiah CS, Samsudin IN, George E, Ranjit LK, Saat NS, Hussein Z, et al.

Malaysian Journal of Medicine and Health Sciences, 2015;11(1):49-62.
MyJurnal

Patients with diabetes have an earlier onset and increased severity of anaemia compared to those with similar degree of renal impairment from other causes. Anaemia is associated with an increased risk of vascular complications. In this study, we determined the prevalence of anaemia in T2DM patients and its association with sociodemographic, clinical and laboratory parameters in an endocrine tertiary hospital in Malaysia. This was a cross-sectional study using retrospective electronic data from January 2011 to December 2013 of 165 T2DM patients in Hospital Putrajaya. Data was analysed using IBM SPSS Statistics version 21.0 for Windows. The prevalence of anaemia was 39.4% and majority had normocytic normochromic (80%), mild (58.5%) anaemia. Majority were Malays (73.9%), aged below 60 with comparable gender percentage and long-standing, poorly-controlled DM [median fasting blood sugar (FBS) 8mmol/L; glycated haemoglobin (HbA1c) 7.9%]. Using the KDIGO chronic kidney disease (CKD) staging system, 86% of these patients were in stages 3-5. Anaemic patients had a significantly higher serum urea, creatinine and a lower FBS, estimated glomerular filtration rate (eGFR) compared to non-anaemic patients. Anaemic patients with diabetic nephropathy had a significantly lower haemoglobin (Hb) compared to those without this complication (p=0.022). The sensitivity and specificity at a cut-off eGFR value of 38.3 ml/min/1.73 m2 (maximum Youden index = 0.462) was 66.7% and 79.5%, respectively to discriminate mild from moderate anaemia. This study shows that anaemia is already present in T2DM patients in Hospital Putrajaya at initial presentation to the specialist outpatient clinic and is significantly associated with CKD. Hence, it emphasises the obligatory need for routine and follow-up full blood count monitoring in T2DM patients in primary care as well as tertiary settings in Malaysia to enable early detection and aggressive correction of anaemia in preventing further complications.

Study site: endocrine clinic, Hospital Putrajaya
Transfusion-dependent thalassemia in Northern Sarawak: a molecular study to identify different genotypes in the multi-ethnic groups and the importance of genomic sequencing in unstudied populations

Tan JA, Chin SS, Ong GB, Mohamed Unni MN, Soosay AE, Gudum HR, et al.

Public Health Genomics, 2015;18(1):60-4.
PMID: 25412720 DOI: 10.1159/000368342

BACKGROUND: Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak.
METHODS: Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing.
RESULTS: Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients.
CONCLUSION: The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations.

Filters

Please provide feedback to Administrator (afdal@afpm.org.my)

External Links