Displaying publications 21 - 40 of 84 in total

Abstract:
Sort:
  1. The use of Taqman genotyping assays for rapid confirmation of β-thalassaemia mutations in the Malays: accurate diagnosis with low DNA concentrations
    Teh LK, Lee TY, Tan JA, Lai MI, George E
    Int J Lab Hematol, 2015 Feb;37(1):79-89.
    PMID: 24725998 DOI: 10.1111/ijlh.12240
    In Malaysia, β-thalassaemia is a common inherited blood disorder in haemoglobin synthesis with a carrier rate of 4.5%. Currently, PCR-incorporating techniques such as amplification refractory mutation system (ARMS) or reverse dot blot hybridization (RDBH) are used in β-thalassaemia mutation detection. ARMS allows single-mutation identification using two reactions, one for wild type and another for mutant alleles. RDBH requires probe immobilization and optimization of hybridization and washing temperatures which is time consuming. The aim of our study was to investigate whether β-thalassaemia mutations can be identified in samples with low DNA concentrations.
  2. Fulltext Contribution of GnIH Research to the Progress of Reproductive Neuroendocrinology
    Tsutsui K, Ubuka T, Son YL, Bentley GE, Kriegsfeld LJ
    Front Endocrinol (Lausanne), 2015;6:179.
    PMID: 26635728 DOI: 10.3389/fendo.2015.00179
    Since the discovery of gonadotropin-releasing hormone (GnRH) in mammals at the beginning of the 1970s, it was generally accepted that GnRH is the only hypothalamic neuropeptide regulating gonadotropin release in mammals and other vertebrates. In 2000, however, gonadotropin-inhibitory hormone (GnIH), a novel hypothalamic neuropeptide that actively inhibits gonadotropin release, was discovered in quail. Numerous studies over the past decade and a half have demonstrated that GnIH serves as a key player regulating reproduction across vertebrates, acting on the brain and pituitary to modulate reproductive physiology and behavior. In the latter case, recent evidence indicates that GnIH can regulate reproductive behavior through changes in neurosteroid, such as neuroestrogen, biosynthesis in the brain. This review summarizes the discovery of GnIH, and the contributions to GnIH research focused on its mode of action, regulation of biosynthesis, and how these findings advance our understanding of reproductive neuroendocrinology.
  3. Transfusion-dependent thalassemia in Northern Sarawak: a molecular study to identify different genotypes in the multi-ethnic groups and the importance of genomic sequencing in unstudied populations
    Tan JA, Chin SS, Ong GB, Mohamed Unni MN, Soosay AE, Gudum HR, et al.
    Public Health Genomics, 2015;18(1):60-4.
    PMID: 25412720 DOI: 10.1159/000368342
    BACKGROUND: Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak.
    METHODS: Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing.
    RESULTS: Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients.
    CONCLUSION: The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations.
  4. Fulltext A novel gap-PCR with high resolution melting analysis for the detection of α-thalassaemia Southeast Asian and Filipino β°-thalassaemia deletion
    Kho SL, Chua KH, George E, Tan JA
    Sci Rep, 2015;5:13937.
    PMID: 26365497 DOI: 10.1038/srep13937
    Homozygosity for the α-thalassaemia Southeast Asian (α-SEA) and Filipino β°-thalassaemia (β-FIL) deletions can cause serious complications leading to foetal death or life-long blood transfusions. A rapid and accurate molecular detection assay is essential in populations where the deletions are common. In this study, gap-polymerase chain reaction (PCR) with high resolution melting (HRM) analysis was developed to detect both the large deletions. Melting curves at 86.9 ± 0.1 °C were generated by normal individuals without the α-SEA deletion, 84.7 ± 0.1 °C by homozygous α-SEA deletion individuals and two melting curves at 84.7 ± 0.1 °C and 86.9 ± 0.1 °C by α-SEA deletion carriers. Normal individuals without the β-FIL deletion produce amplicons with a melting temperature (Tm) at 74.6 ± 0.1 °C, homozygous β-FIL individuals produce amplicons with Tm at 73.6 ± 0.1 °C and heterozygous β-FIL individuals generate two amplicons with Tm at 73.6 ± 0.1 °C and 74.6 ± 0.1 °C. Evaluation using blinded tests on 220 DNA samples showed 100% sensitivity and specificity. The developed assays are sensitive and specific for rapid molecular and prenatal diagnosis for the α-SEA and β-FIL deletions.
  5. Fulltext Anaemia in type 2 diabetes mellitus (T2DM) patients in Hospital Putrajaya
    Thambiah CS, Samsudin IN, George E, Ranjit LK, Saat NS, Hussein Z, et al.
    Malaysian Journal of Medicine and Health Sciences, 2015;11(1):49-62.
    MyJurnal
    Patients with diabetes have an earlier onset and increased severity of anaemia compared to those with similar degree of renal impairment from other causes. Anaemia is associated with an increased risk of vascular complications. In this study, we determined the prevalence of anaemia in T2DM patients and its association with sociodemographic, clinical and laboratory parameters in an endocrine tertiary hospital in Malaysia. This was a cross-sectional study using retrospective electronic data from January 2011 to December 2013 of 165 T2DM patients in Hospital Putrajaya. Data was analysed using IBM SPSS Statistics version 21.0 for Windows. The prevalence of anaemia was 39.4% and majority had normocytic normochromic (80%), mild (58.5%) anaemia. Majority were Malays (73.9%), aged below 60 with comparable gender percentage and long-standing, poorly-controlled DM [median fasting blood sugar (FBS) 8mmol/L; glycated haemoglobin (HbA1c) 7.9%]. Using the KDIGO chronic kidney disease (CKD) staging system, 86% of these patients were in stages 3-5. Anaemic patients had a significantly higher serum urea, creatinine and a lower FBS, estimated glomerular filtration rate (eGFR) compared to non-anaemic patients. Anaemic patients with diabetic nephropathy had a significantly lower haemoglobin (Hb) compared to those without this complication (p=0.022). The sensitivity and specificity at a cut-off eGFR value of 38.3 ml/min/1.73 m2 (maximum Youden index = 0.462) was 66.7% and 79.5%, respectively to discriminate mild from moderate anaemia. This study shows that anaemia is already present in T2DM patients in Hospital Putrajaya at initial presentation to the specialist outpatient clinic and is significantly associated with CKD. Hence, it emphasises the obligatory need for routine and follow-up full blood count monitoring in T2DM patients in primary care as well as tertiary settings in Malaysia to enable early detection and aggressive correction of anaemia in preventing further complications.

    Study site: endocrine clinic, Hospital Putrajaya
  6. Molecular basis of transfusion dependent beta-thalassemia major patients in Sabah
    Teh LK, George E, Lai MI, Tan JA, Wong L, Ismail P
    J Hum Genet, 2014 Mar;59(3):119-23.
    PMID: 24369358 DOI: 10.1038/jhg.2013.131
    Beta-thalassemia is one of the most prevalent inherited diseases and a public health problem in Malaysia. Malaysia is geographically divided into West and East Malaysia. In Sabah, a state in East Malaysia, there are over 1000 estimated cases of β-thalassemia major patients. Accurate population frequency data of the molecular basis of β-thalassemia major are needed for planning its control in the high-risk population of Sabah. Characterization of β-globin gene defects was done in 252 transfusion dependent β-thalassemia patients incorporating few PCR techniques. The study demonstrates that β-thalassemia mutations inherited are ethnically dependent. It is important to note that 86.9% of transfusion-dependent β-thalassemia major patients in Sabah were of the indigenous population and homozygous for a single mutation. The Filipino β(0)-deletion was a unique mutation found in the indigenous population of Sabah. Mutations common in West Malaysia were found in 11 (4.3%) patients. Four rare mutations (Hb Monroe, CD 8/9, CD 123/124/125 and IVS I-2) were also found. This study is informative on the population genetics of β-thalassemia major in Sabah.
  7. Fulltext Genome-wide association study of susceptibility to infection by Mycobacterium avium subspecies paratuberculosis in Holstein cattle
    Alpay F, Zare Y, Kamalludin MH, Huang X, Shi X, Shook GE, et al.
    PLoS One, 2014;9(12):e111704.
    PMID: 25473852 DOI: 10.1371/journal.pone.0111704
    Paratuberculosis, or Johne's disease, is a chronic, granulomatous, gastrointestinal tract disease of cattle and other ruminants caused by the bacterium Mycobacterium avium, subspecies paratuberculosis (MAP). Control of Johne's disease is based on programs of testing and culling animals positive for infection with MAP while concurrently modifying management to reduce the likelihood of infection. The current study is motivated by the hypothesis that genetic variation in host susceptibility to MAP infection can be dissected and quantifiable associations with genetic markers identified. For this purpose, a case-control, genome-wide association study was conducted using US Holstein cattle phenotyped for MAP infection using a serum ELISA and/or fecal culture test. Cases included cows positive for either serum ELISA, fecal culture or both. Controls consisted of animals negative for the serum ELISA test or both serum ELISA and fecal culture when both were available. Controls were matched by herd and proximal birth date with cases. A total of 856 cows (451 cases and 405 controls) were used in initial discovery analyses, and an additional 263 cows (159 cases and 104 controls) from the same herds were used as a validation data set. Data were analyzed in a single marker analysis controlling for relatedness of individuals (GRAMMAR-GC) and also in a Bayesian analysis in which multiple marker effects were estimated simultaneously (GenSel). For the latter, effects of non-overlapping 1 Mb marker windows across the genome were estimated. Results from the two discovery analyses were generally concordant; however, discovery results were generally not well supported in analysis of the validation data set. A combined analysis of discovery and validation data sets provided strongest support for SNPs and 1 Mb windows on chromosomes 1, 2, 6, 7, 17 and 29.
  8. Fulltext Prevalence of dyslipidaemia in type 2 diabetes mellitus patients and Its association to diabetic retinopathy in a Malaysian tertiary hospital
    Samsudin IN, Md Saleh R, Thambiah SC, Mohamad Amir Hamzah AS, Wan Khalik WNF, George E
    Malaysian Journal of Medicine and Health Sciences, 2014;10(2):47-51.
    MyJurnal
    Background: Diabetic retinopathy (DR) is a microvascular complication of diabetes, which is a cause of visual impairment and blindness. Its development and progression have been linked to dyslipidaemia, although the link remains inconclusive.
    Aim: This study aimed to determine the prevalence of dyslipidaemia among type 2 diabetic patients with DR in a tertiary setting and to determine the association between dyslipidaemia and DR severity.
    Materials and methods: This was a cross sectional study using retrospective data of type 2 diabetic patients attending the opthalmology clinic of a tertiary centre from January 2007 to June 2014. Results of their fasting lipid profile and clinical data were retrieved from the hospital information system.
    Results: A total of 178 patient’s data were collected. 120 (n=67.4%) patients had non-proliferative diabetic retinopathy (NDPR) with moderate NPDR being the most prevalent. Dyslipidaemia was noted in 151 (84.8%) of the patients. Patients had a combination of more than one abnormality in the lipid profile with increased LDL-cholesterol being the main abnormality. Dyslipidaemia was however, not significantly associated with DR severity.
    Conclusion: Dyslipidaemia was highly prevalent in DR patients. The dyslipidaemia was however not associated with severity of DR.
    Study site: Ophthalmology clinic, Hospital (?name), Malaysia
  9. Mesenchymal stem cells of human placenta and umbilical cord suppress T-cell proliferation at G0 phase of cell cycle
    Vellasamy S, Sandrasaigaran P, Vidyadaran S, Abdullah M, George E, Ramasamy R
    Cell Biol Int, 2013 Mar;37(3):250-6.
    PMID: 23364902 DOI: 10.1002/cbin.10033
    Mesenchymal stem cells (MSC) generated from human umbilical cord (UC-MSC) and placenta (PLC-MSC) were assessed and compared for their immunomodulatory function on T cells proliferation by analysis of the cell cycle. Mitogen stimulated or resting T cells were co-cultured in the presence or absence of MSC. T-cell proliferation was assessed by tritiated thymidine ((3) H-TdR) assay and the mechanism of inhibition was examined bycell cycle and apoptosis assay. Both UC-MSC and PLC-MSC profoundly inhibited the proliferation of T-cell, mainly via cell-to-cell contact. MSC-mediated anti-proliferation does not lead to apoptosis,but prevented T cells from entering S phase and they therefore accumulated in the G(0) /G(1) phases. The anti-proliferative activity of MSC was related to this cell cycle arrest of T-cell. UC-MSC produced a greater inhibition than PLC-MSC in all measured parameters.
  10. HbA2 levels in β-thalassaemia carriers with the Filipino β0-deletion: are the levels higher than what is found with non-deletional forms of β0-thalassaemia?
    George E, Teh LK, Tan J, Lai MI, Wong L
    Pathology, 2013 01;45(1):62-5.
    PMID: 23222244 DOI: 10.1097/PAT.0b013e32835af7c1
    AIMS: Classical carriers of β-thalassaemia are identified by a raised HbA2 level. Earlier studies indicated that the Filipino β-deletion has high raised HbA2 levels. The introduction of automated high performance liquid chromatography (HPLC) for thalassaemia screening is an important advance in technology for haematology laboratories. The BioRad Variant II Hb analyser is a common instrument used to quantify HbA2 levels in thalassaemia screening. This study aimed to determine HbA2 levels in carriers of Filipino β-mutation using the BioRad Variant II Hb analyser.

    METHODS: The Filipino β-deletion was identified using gap-polymerase chain reaction (PCR) in the parents of transfusion dependent β-thalassaemia patients who were homozygous for the Filipino β-deletion in the indigenous population of Sabah, Malaysia. Hb subtypes were quantified on the BioRad Variant II Hb analyser. Concurrent α-thalassaemia was identified by multiplex gap-PCR for deletions and amplification refractory mutation system (ARMS)-PCR for non-deletional mutations.

    RESULTS: The mean HbA2 level for Filipino β-thalassaemia trait was 5.9 ± 0.47 and with coinheritance of α-thalassaemia was 6.3 ± 0.44 (-α heterozygous) and 6.7 ± 0.36 (-α homozygous). The HbA2 levels were all >4% in keeping with the findings of classical β-thalassaemia trait and significantly higher than levels seen in non-deletional forms of β-thalassaemia.

    CONCLUSION: The HbA2 level measured on the BioRad Variant II Hb analyser was lower than the level in the first description of the Filipino β-thalassaemia. β-thalassaemia trait with coinheritance of α-thalassaemia (-α) is associated with significantly higher HbA2 level.

  11. Fulltext Specific and straightforward molecular investigation of β-thalassemia mutations in the Malaysian Malays and Chinese using direct TaqMan genotyping assays
    Kho SL, Chua KH, George E, Tan JA
    Genet. Mol. Res., 2013;12(3):2409-15.
    PMID: 23479149 DOI: 10.4238/2013.February.28.4
    Beta-thalassemia is a life-threatening inherited blood disorder. Rapid characterization of β-globin gene mutations is necessary because of the high frequency of Malaysian β-thalassemia carriers. A combination real-time polymerase chain reaction genotyping assay using TaqMan probes was developed to confirm β-globin gene mutations. In this study, primers and probes were designed to specifically identify 8 common β-thalassemia mutations in the Malaysian Malay and Chinese ethnic groups using the Primer Express software. "Blind tests" using DNA samples from healthy individuals and β-thalassemia patients with different genotypes were performed to determine the specificity and sensitivity of this newly designed assay. Our results showed 100% sensitivity and specificity for this novel assay. In conclusion, the TaqMan genotyping assay is a straightforward assay that allows detection of β-globin gene mutations in less than 40 min. The simplicity and reproducibility of the TaqMan genotyping assay permit its use in laboratories as a rapid and cost-effective diagnostic tool for confirmation of common β-thalassemia mutations in Malaysia.
  12. Fulltext High throughput molecular confirmation of β-thalassemia mutations using novel TaqMan probes
    Kho SL, Chua KH, George E, Tan JA
    Sensors (Basel), 2013;13(2):2506-14.
    PMID: 23429513 DOI: 10.3390/s130202506
    β-Thalassemia is a public health problem where 4.5% of Malaysians are β-thalassemia carriers. The genetic disorder is caused by defects in the β-globin gene complex which lead to reduced or complete absence of β-globin chain synthesis. Five TaqMan genotyping assays were designed and developed to detect the common β-thalassemia mutations in Malaysian Malays. The assays were evaluated with 219 "blinded" DNA samples and the results showed 100% sensitivity and specificity. The in-house designed TaqMan genotyping assays were found to be cost- and time-effective for characterization of β-thalassemia mutations in the Malaysian population. 
  13. Fulltext Serum soluble transferrin receptor concentration as a biomarker of erythropoietic activity: surrogate marker of adequate transfusion in adult beta-thalassaemia intermedia patients
    Thambiah, S., George, E., Nor Aini, U., Sathar, J., Zarida, H., Mokhtar, A.B.
    Malaysian Journal of Medicine and Health Sciences, 2013;9(2):3-12.
    MyJurnal
    Management of Beta (β)-thalassaemia intermedia in contrast to β-thalassaemia major patients has no clear guidelines as to indicators of adequate transfusion. Regular blood transfusion suppresses bone marrow erythropoietic activity. Serum soluble transferrin receptor (sTfR) concentration is a marker for erythropoietic activity, with increased sTfR being associated with functional iron deficiency and increased erythropoietic activity. This study aimed to determine the use of sTfR as an indicator of adequate transfusion in adult β-thalassaemia intermedia patients. A cross-sectional study was conducted at Hospital Ampang, Malaysia, for six months. Patient group included six β-thalassaemia intermedia and 34 HbE-β-thalassaemia transfused patients. None of the patients were on regular monthly blood transfusions as in β-thalassaemia major. The control group comprised of 16 healthy subjects with normal haematological parameters. Haemoglobin (Hb) analysis, sTfR and ferritin assays were performed. Hb and HbA percentages (%) were found to be significantly lower in patients compared to the controls, while HbE%, HbF%, sTfR and ferritin were significantly higher in patients. An inverse relationship was found in the controls between HbF% with Hb (r = -0.515, p < 0.05) and HbA% (r = -0.534, p < 0.05). In patients, sTfR showed an inverse relationship with HbA% (r = -0.618, p = 0.000) and a positive correlation with HbE% (r = 0.418, p = 0.007) and HbF% (r = 0.469, p = 0.002). Multivariate analysis showed that HbA% (r = 2.875, p = 0.048), HbE% (r = 2.872, p = 0.020) and HbF% (r = 2.436, p = 0.013) best predicted sTfR independently in patients. Thus, sTfR is a useful marker for erythropoiesis. The elevated sTfR in these patients indicate that the transfusion regimen used was inadequate to suppress ineffective erythropoiesis. Hb levels may not be the best target for monitoring transfusion treatment in β-thalassaemia intermedia patients, but the use of sTfR is helpful in individualising transfusion regimens.
  14. Isolation and characterisation of mesenchymal stem cells derived from human placenta tissue
    Vellasamy S, Sandrasaigaran P, Vidyadaran S, George E, Ramasamy R
    World J Stem Cells, 2012 Jun 26;4(6):53-61.
    PMID: 22993662
    To explore the feasibility of placenta tissue as a reliable and efficient source for generating mesenchymal stem cells (MSC).
  15. α-Haemoglobin stabilising protein expression is influenced by mean cell haemoglobin and HbF levels in HbE/β-thalassaemia individuals
    Lim WF, Muniandi L, George E, Sathar J, Teh LK, Gan GG, et al.
    Blood Cells Mol. Dis., 2012 Jan 15;48(1):17-21.
    PMID: 22079025 DOI: 10.1016/j.bcmd.2011.10.002
    The alpha haemoglobin stabilising protein (AHSP) acts as a molecular chaperone for α-globin by stabilising nascent α-globin before transferring it to waiting free β-globin chains. Binding of AHSP to α-globin renders α-globin chemically inert whereby preventing it from precipitating and forming reactive oxygen species byproducts. The AHSP has been actively studied in the recent years, particularly in its relation to β-thalassaemia. Studies have shown that AHSP is a modifier in β-thalassaemia mice models. However, this relationship is less established in humans. Studies by some groups showed no correlation between the AHSP haplotypes and the severity of β-thalassaemia, whereas others have shown that certain AHSP haplotype could modify the phenotype of β-thalassaemia intermedia patients. We investigated the expression of AHSP in relation to selected demographic data, full blood count, HPLC results, HbE/β-thalassaemia genotype, Xmn-1 Gγ polymorphism, α-globin, β-globin and γ-globin expression. We found that AHSP expression was significantly correlated to mean cell haemoglobin level, HbF %, α-globin, β-globin and excess α-globin expression. We concluded that AHSP could be a secondary compensatory mechanism in red blood cells to counterbalance the excess α-globin chains in HbE/β-thalassaemia individuals.
  16. Fulltext Beta thalassaemia mutations in Malays: a simplified cost-effective strategy to identify the mutations
    George, E., Teh, L.K., Rosli, R., Lai, M.I., Tan, J.A.M.A.
    Malaysian Journal of Medicine and Health Sciences, 2012;8(1):45-53.
    MyJurnal
    Beta (β)- thalassaemia is a public health problem in Malaysia. The carrier rate is estimated to be 4.5% by micro-mapping studies particularly among Malays who comprise 53.5% of the population in Malaysia. The common diagnostic method in Malaysia for mutation detection is by amplification refractory mutation system (ARMS). It allows single mutation detection in each reaction but is labour intensive and time consuming when many mutations need to be identified. The purpose of this study was to develop a diagnostic tool for effective mutation detection of beta thalassaemia in Malay patients and compare its efficacy with ARMS-PCR, the current method in use. Methods: Reverse dot blot hybridization (RDBH) technique was incorporated in the development of two strip assays [RDBH-Strip M(6) and RDBH-Strip C(6)] to identify common beta thalassaemia mutations in the Malays. The panels of selected mutations were based on the mutation frequencies in Malaysia reported in previous studies. RDBH-Strip M(6) was applied as step 1 and RDBH-Strip C(6) was applied as step 2 for unidentified mutations. The strips were validated with the gold standard method, ARMS- PCR. Results: One hundred and thirty seven Malay patients with 274 alleles were studied. In Step 1 mutation detection, 238 alleles (86.9%) were identified in 119 of patients by RDBH-Strip M(6). Step 2 resulted in a further detection of 20 alleles in another 10 patients by RDBH-Strip C(6). The combination of both strips resulted in the identification of 258 alleles in 129 (94.6%) of 137 Malay patients. The strip assays were 100% sensitive and specific when compared with ARMS-PCR method. Conclusion: Two strip assays utilising the RDBH technique were developed to identify common β-thalassaemia mutations in Malays. The RDBH Strip M(6) identified 86.9% of the mutations and the RDBH-Strip C (6) detected further 7.3% alleles. This two step strategy was found to be rapid and cost effective for the direct diagnosis of β-thalassaemia mutations in the Malays. The remaining unidentified mutations would require DNA sequencing. It can serve as a specific molecular diagnostic tool for effective diagnosis of
    β-thalassaemia mutations in this ethnic group.
  17. Fulltext Screening for intermediate and severe forms of thalassaemia in discarded red blood cells: optimization and feasibility
    George E, Lai MI, Teh LK, Ramasamy R, Goh EH, Asokan K, et al.
    Med J Malaysia, 2011 Dec;66(5):429-34.
    PMID: 22390095 MyJurnal
    Detection and quantification of Hb subtypes of human blood is integral to presumptive identification of thalassaemias. It has been used in neonatal screening of thalassaemia and Hb variants. The use of discarded red blood cells following processing of the cord blood for stem cells provides readily available diagnostic material for thalassaemia screening. In this study, we determined the range of Hb subtypes in 195 consecutive cord blood samples collected for cord blood banking. The 'cord blood samples' analysed were those of the remaining red blood cells after the cord blood was processed for stem cell storage. Quantification of Hb subtypes by high performance liquid chromatography (HPLC) was done on BioRad Variant II Hb testing system. Only 73 (36.5%) of the samples could be analyzed neat without dilution. With a 1:300 dilution with wash solution the acceptable area as recommended by the manufacturer for reading of a C-gram within the 1 to 3 million ranges were achieved in all. Eighteen (9%) 12 showed classical Hb Barts (y4) prerun peaks were confirmed by Sebia Hydrasys automated Hb gel electrophoresis and quantified by Sebia Capillarys 2 capillary electrophoresis. Only 1 (0.5%) was presumptively identified with HbH disease. Due to the limited number of samples no beta-thalassaemia major, Hb E beta-thalassaemia and Hb Barts hydrops fetalis were found. The HPLC assay was possible at a cost US$ 5 per sample and a turnover time of 10 samples per hour without technical difficulties. This study reports an effective and valuable protocol for thalassaemia screening in red blood cells which would otherwise be discarded during cord blood processing. Cord blood with severe and intermediate forms of thalassaemia can be preselected and not stored.
  18. Human mesenchymal stem cells protect neutrophils from serum-deprived cell death
    Maqbool M, Vidyadaran S, George E, Ramasamy R
    Cell Biol Int, 2011 Dec;35(12):1247-51.
    PMID: 21649586 DOI: 10.1042/CBI20110070
    We have previously shown that human MSC (mesenchymal stem cells) inhibit the proliferation of most of the immune cells. However, there are innate immune cells such as neutrophils and other PMN (polymorphonuclear) cells that do not require an extensive proliferation prior to their effector function. In this study, the effect of MSC on neutrophils in the presence of complete and serum-deprived culture media was investigated. In the presence of MSC, the viability of neutrophils increase as measured in 24 h of incubation at various supplementation of serum concentration. We have utilized Annexin V and PI (propidium iodide) staining to confirm whether the enhancement of neutrophil's viability is due to a reduction in PCD (programmed cell death). MSC significantly rescue neutrophils from apoptosis at 1, 5 and 10% of FBS (fetal bovine serum) supplementation. The fractions of viable and dead cells were increased and decreased respectively in the presence of MSC. Our results indicate MSC rescue neutrophils from nutrient- or serum-deprived cell death. However, whether this effect is exerted through a specific signalling pathway or confining neutrophils in resting state by MSC requires further investigation.
  19. Fulltext Optimisation of laboratory procedures for isolating human peripheral blood derived neutrophils
    Maqbool M, Vidyadaran S, George E, Ramasamy R
    Med J Malaysia, 2011 Oct;66(4):296-9.
    PMID: 22299545 MyJurnal
    Functional analysis of neutrophils requires isolation of these cells in the laboratory. Current isolation procedures are time consuming and can potentially activate the resting neutrophils. Thus, in this present study, we have optimised an existing laboratory protocol for human neutrophil isolation from peripheral blood. Twenty ml of blood samples were subjected to optimised density gradient separation and dextran sedimentation to obtain a pure population of neutrophils. The efficacy of the optimised manual post isolation of neutrophils was compared with pre isolation count performed by an automated haematology analyzer. The recovery of neutrophils via our optimised methods was 65.5% in comparison with neutrophils counts at pre-isolation. The morphological analysis of isolated neutrophils indicated the purity level more than 95% using Leishman staining. Our optimised laboratory procedures for neutrophils isolation successfully harvested neutrophils with good viability, purity and post recovery yield. This procedure provides an ideal platform to separate neutrophils for in vitro studies.
  20. An assessment of three noncommercial DNA extraction methods from dried blood spots for beta-thalassaemia mutation identification
    Karthipan SN, George E, Jameela S, Lim WF, Teh LK, Lee TY, et al.
    Int J Lab Hematol, 2011 Oct;33(5):540-4.
    PMID: 21884505 DOI: 10.1111/j.1751-553X.2011.01304.x
    Dried blood spots (DBS) are currently the recommended sample collection method for newborn screening programmes in America. Early diagnosis of beta-thalassaemia screening is essential as it provides an added advantage especially in sickle cell disease. Beta-thalassaemia frequency is high in many poor countries, and the cost of using commercial DNA extraction kits can be prohibitive. Our study assessed three methods that use minimal reagents and materials to extract DNA from DBS for beta-thalassaemia identification.
Related Terms
Filters
Contact Us

Please provide feedback to Administrator (afdal@afpm.org.my)

External Links