MyMedR

Displaying publications 21 - 40 of 47 in total

Abstract:

Sort:

The use of Taqman genotyping assays for rapid confirmation of β-thalassaemia mutations in the Malays: accurate diagnosis with low DNA concentrations

Teh LK, Lee TY, Tan JA, Lai MI, George E

Int J Lab Hematol, 2015 Feb;37(1):79-89.
PMID: 24725998 DOI: 10.1111/ijlh.12240

In Malaysia, β-thalassaemia is a common inherited blood disorder in haemoglobin synthesis with a carrier rate of 4.5%. Currently, PCR-incorporating techniques such as amplification refractory mutation system (ARMS) or reverse dot blot hybridization (RDBH) are used in β-thalassaemia mutation detection. ARMS allows single-mutation identification using two reactions, one for wild type and another for mutant alleles. RDBH requires probe immobilization and optimization of hybridization and washing temperatures which is time consuming. The aim of our study was to investigate whether β-thalassaemia mutations can be identified in samples with low DNA concentrations.
Rapid detection of α-thalassaemia variants using droplet digital PCR

Lee TY, Lai MI, Ramachandran V, Tan JA, Teh LK, Othman R, et al.

Int J Lab Hematol, 2016 Aug;38(4):435-43.
PMID: 27349818 DOI: 10.1111/ijlh.12520

INTRODUCTION: Alpha thalassaemia is a highly prevalent disease globally and is a well-known public health problem in Malaysia. The deletional forms of the mutation are the most common forms found in alpha thalassaemia. The three most common deletional alpha thalassaemia found in this region include --(SEA) deletion, -α(3.7) rightward and -α(4.2) leftward deletions. The prevalence rate of triplication alpha cases such as ααα(anti3.7) and ααα(anti4.2) is not known in Malaysia although it plays a role in exacerbating the clinical phenotypes in beta thalassaemia carriers. Recently, there have been more reported cases of rare alpha thalassaemia mutations due to the advancement of molecular techniques involved in thalassaemia detections. Therefore, it is essential to develop a new method which allows the detection of different alpha thalassaemia mutations including the rare ones simultaneously and accurately.
METHODS: The purpose of this study was to design an assay for the detection of triplications, common and rare deletional alpha thalassaemia using droplet digital PCR (ddPCR).
RESULTS: This is a quantitative detection method to measure the changes of copy number which can detect deletions, duplications and triplications of the alpha globin gene simultaneously.
CONCLUSION: In conclusion, ddPCR is an alternative method for rapid detection of alpha thalassaemia variants in Malaysia.
Fulltext High prevalence of alpha- and beta-thalassemia in the Kadazandusuns in East Malaysia: challenges in providing effective health care for an indigenous group

Tan JA, Lee PC, Wee YC, Tan KL, Mahali NF, George E, et al.

J Biomed Biotechnol, 2010;2010.
PMID: 20871816 DOI: 10.1155/2010/706872

Thalassemia can lead to severe transfusion-dependent anemia, and it is the most common genetic disorder in Malaysia. This paper aims to determine the prevalence of thalassemia in the Kadazandusuns, the largest indigenous group in Sabah, East Malaysia. α- and β-thalassemia were confirmed in 33.6% and 12.8%, of the individuals studied respectively. The high prevalence of α- and β-thalassemia in the Kadazandusuns indicates that thalassemia screening, genetic counseling, and prenatal diagnosis should be included as part of their healthcare system. This preliminary paper serves as a baseline for further investigations into the health and genetic defects of the major indigenous population in Sabah, East Malaysia.
Fulltext A holistic approach to education programs in thalassemia for a multi-ethnic population: consideration of perspectives, attitudes, and perceived needs

Wong LP, George E, Tan JA

J Community Genet, 2011 Jun;2(2):71-9.
PMID: 22109791 DOI: 10.1007/s12687-011-0039-z

Hemoglobin disorders which include thalassemias are the most common heritable disorders. Effective treatment is available, and these disorders can be avoided as identification of carriers is achievable using simple hematological tests. An in-depth understanding of the awareness, attitudes, perceptions, and screening reservations towards thalassemia is necessary, as Malaysia has a multi-ethnic population with different religious beliefs. A total of 13 focus group discussions (70 participants) with members of the general lay public were conducted between November 2008 and January 2009. Lack of knowledge and understanding about thalassemia leads to general confusions over differences between thalassemia carriers and thalassemia major, inheritance patterns, and the physical and psychologically impact of the disorder in affected individuals and their families. Although most of the participants have not been tested for thalassemia, a large majority expressed willingness to be screened. Views on prenatal diagnosis and termination of fetuses with thalassemia major received mixed opinions from participants with different religions and practices. Perceived stigma and discrimination attached to being a carrier emerged as a vital topic in some group discussions where disparity in the answers exhibited differences in levels of participants' literacy and ethnic origins. The two most common needs identified from the discussion were information and screening facilities. Participants' interest in knowing the severity of the disease and assessing their risk of getting the disorder may imply the health belief model as a possible means of predicting thalassemia public screening services. Findings provide valuable insights for the development of more effective educational, screening, and prenatal diagnostic services in the multi-ethnic Asian society.
Molecular basis of transfusion dependent beta-thalassemia major patients in Sabah

Teh LK, George E, Lai MI, Tan JA, Wong L, Ismail P

J Hum Genet, 2014 Mar;59(3):119-23.
PMID: 24369358 DOI: 10.1038/jhg.2013.131

Beta-thalassemia is one of the most prevalent inherited diseases and a public health problem in Malaysia. Malaysia is geographically divided into West and East Malaysia. In Sabah, a state in East Malaysia, there are over 1000 estimated cases of β-thalassemia major patients. Accurate population frequency data of the molecular basis of β-thalassemia major are needed for planning its control in the high-risk population of Sabah. Characterization of β-globin gene defects was done in 252 transfusion dependent β-thalassemia patients incorporating few PCR techniques. The study demonstrates that β-thalassemia mutations inherited are ethnically dependent. It is important to note that 86.9% of transfusion-dependent β-thalassemia major patients in Sabah were of the indigenous population and homozygous for a single mutation. The Filipino β(0)-deletion was a unique mutation found in the indigenous population of Sabah. Mutations common in West Malaysia were found in 11 (4.3%) patients. Four rare mutations (Hb Monroe, CD 8/9, CD 123/124/125 and IVS I-2) were also found. This study is informative on the population genetics of β-thalassemia major in Sabah.
Fulltext Characterisation of beta-globin gene mutations in Malaysian children: a strategy for the control of beta-thalassaemia in a developing country

Thong MK, Tan JA, Tan KL, Yap SF

J Trop Pediatr, 2005 Dec;51(6):328-33.
PMID: 15967770 DOI: 10.1093/tropej/fmi052

beta-thalassaemia major, an autosomal recessive hemoglobinopathy, is one of the most common single gene disorders in multi-racial Malaysia. The control of beta-thalassaemia major requires a multi-disciplinary approach that includes population screening, genetic counselling, prenatal diagnosis and the option of termination of affected pregnancies. To achieve this objective, the molecular characterisation of the spectrum of beta-globin gene mutations in each of the affected ethnic groups is required. We studied 88 consecutive unrelated individuals and their respective families with beta-thalassaemia (74 beta-thalassaemia major, 12 HbE-beta-thalassaemia, 2 with HbE homozygotes) and four individuals with beta-thalassaemia trait that contributed a total 180 alleles for study. Using a 2-step molecular diagnostic strategy consisting of amplification refractory mutation system (ARMS) to identify the 8 most common mutations followed by other DNA-based diagnostic techniques, a total of 177 (98.3 per cent) of the 180 beta-thalassaemia alleles were characterised. One out of 91 (1 per cent) of the Chinese alleles, one out of 46 (2.2 per cent) Malay alleles and one out of two Indian alleles remained unknown. A 100 per cent success rate was achieved in studying the Kadazandusun community in this study. A strategy to identify beta-globin gene mutations in Malaysians with beta-thalassaemia is proposed based on this outcome.
Fulltext Transtubular Transoral Approach for Irreducible Ventral Craniovertebral Junction Compressive Pathologies: Surgical Technique and Outcome

Ariffin MH, Mohd-Mahdi SN, Baharudin A, M Tamil A, Abdul-Rhani S, Ibrahim K, et al.

Malays Orthop J, 2023 Jul;17(2):35-42.
PMID: 37583520 DOI: 10.5704/MOJ.2307.006

INTRODUCTION: To investigate the use of a tubular retractor to provide access to the craniovertebral junction (CVJ) sparing the soft palate with the aim of reducing complications associated with traditional transoral approach but yet allowing adequate decompression of the CVJ.
MATERIALS AND METHODS: Twelve consecutive patients with severe myelopathy (JOA-score less than 11) from ventral CVJ compression were operated between 2014-2020 using a tubular retractor assisted transoral decompression.
RESULTS: All patients improved neurologically statistically (p=0.02). There were no posterior pharynx wound infections or rhinolalia. There was one case with incomplete removal of the lateral wall of odontoid and one incidental durotomy.
CONCLUSIONS: A Tubular retractor provides adequate access for decompression of the ventral compression of CVJ. As the tubular retractor pushed away the uvula, soft palate and pillars of the tonsils as it docked on the posterior pharyngeal wall, the traditional complications associated with traditional transoral procedures is completely avoided.
Characterisation and confirmation of rare beta-thalassaemia mutations in the Malay, Chinese and Indian ethnic groups in Malaysia

Tan JA, Chin PS, Wong YC, Tan KL, Chan LL, George E

Pathology, 2006 Oct;38(5):437-41.
PMID: 17008283

In Malaysia, about 4.5% of the Malay and Chinese populations are heterozygous carriers of beta-thalassaemia. The initial identification of rare beta-globin gene mutations by genomic sequencing will allow the development of simpler and cost-effective PCR-based techniques to complement the existing amplification refractory mutation system (ARMS) and gap-PCR used for the identification of beta-thalassaemia mutations.
Higher frequency of p53 gene mutations in diffuse large B-cell lymphoma with MALT component

Tai YC, Tan JA, Peh SC

Pathol. Int., 2004 Nov;54(11):811-8.
PMID: 15533223

p53 gene mutation is not a frequent event in the tumorigenesis of lymphomas and the expression of p53 protein is independent of p53 gene mutations. The present study aimed to investigate mutations in the p53 gene in a series of extranodal B-cell lymphomas, and its association with p53 protein expression. A total of 52 cases were graded histologically into Grade 1, Grade 2 and Grade 3 tumors and p53 protein expression was detected using immunohistochemistry. Mutations in the p53 gene were analyzed using polymerase chain reaction single-strand conformation polymorphism (PCR-SSCP) and mobility shifts were confirmed by direct sequencing. The tumors comprised 26 (50%) Grade 1, 9 (17%) Grade 2 and 15 (29%) Grade 3. A high proportion of Grade 2 (25%) tumors expressed p53 protein (P = 0.051) and carried p53 gene mutation (33%) (P = 0.218). However, p53 protein expression was not associated with p53 gene mutations (P = 0.057). Transversion mutations (88%) were more frequently detected than transition mutations (12%). The present study revealed that p53 gene mutations and p53 protein expression occurred in higher frequencies in Grade 2 tumors, which may be of pathogenetic importance. The high frequency of transversion mutations may reflect the influence of an etiological agent in the tumorigenesis of mucosa-associated lymphoid tissue (MALT lymphoma).
Fulltext Association of the receptor for advanced glycation end-products (RAGE) gene polymorphisms in Malaysian patients with chronic kidney disease

Wong FN, Chua KH, Kuppusamy UR, Wong CM, Lim SK, Tan JA

PeerJ, 2016;4:e1908.
PMID: 27114872 DOI: 10.7717/peerj.1908

Chronic kidney disease (CKD) is a condition associated with progressive loss of kidney function and kidney damage. The two common causes of CKD are diabetes mellitus and hypertension. Other causes of CKD also include polycystic kidney disease, obstructive uropathy and primary glomerulonephritis. The receptor for advanced glycation end-products (RAGE) is a multi-ligand cell surface receptor of the immunoglobulin superfamily and it has been associated with kidney disease in both non-diabetic and diabetic patients. Presently, data on the association between RAGE polymorphisms and CKD in the Malaysian population is limited, while numerous studies have reported associations of RAGE polymorphisms with diabetic complications in other populations. The present study aims to explore the possibility of using RAGE polymorphisms as candidate markers of CKD in Malaysian population by using association analysis.
Fulltext Phenotypic and Genetic Diversity of Aeromonas Species Isolated from Fresh Water Lakes in Malaysia

Khor WC, Puah SM, Tan JA, Puthucheary SD, Chua KH

PLoS One, 2015;10(12):e0145933.
PMID: 26710336 DOI: 10.1371/journal.pone.0145933

Gram-negative bacilli of the genus Aeromonas are primarily inhabitants of the aquatic environment. Humans acquire this organism from a wide range of food and water sources as well as during aquatic recreational activities. In the present study, the diversity and distribution of Aeromonas species from freshwater lakes in Malaysia was investigated using glycerophospholipid-cholesterol acyltransferase (GCAT) and RNA polymerase sigma-factor (rpoD) genes for speciation. A total of 122 possible Aeromonas strains were isolated and confirmed to genus level using the API20E system. The clonality of the isolates was investigated using ERIC-PCR and 20 duplicate isolates were excluded from the study. The specific GCAT-PCR identified all isolates as belonging to the genus Aeromonas, in agreement with the biochemical identification. A phylogenetic tree was constructed using the rpoD gene sequence and all 102 isolates were identified as: A. veronii 43%, A. jandaei 37%, A. hydrophila 6%, A. caviae 4%, A. salmonicida 2%, A. media 2%, A. allosaccharophila 1%, A. dhakensis 1% and Aeromonas spp. 4%. Twelve virulence genes were present in the following proportions--exu 96%, ser 93%, aer 87%, fla 83%, enolase 70%, ela 62%, act 54%, aexT 33%, lip 16%, dam 16%, alt 8% and ast 4%, and at least 2 of these genes were present in all 102 strains. The ascV, aexU and hlyA genes were not detected among the isolates. A. hydrophila was the main species containing virulence genes alt and ast either present alone or in combination. It is possible that different mechanisms may be used by each genospecies to demonstrate virulence. In summary, with the use of GCAT and rpoD genes, unambiguous identification of Aeromonas species is possible and provides valuable data on the phylogenetic diversity of the organism.
Fulltext Assessment of Risk and Sero-Prevalence of Helicobacter pylori Colonization among Remote Orang Asli Tribes in Peninsula Malaysia

Thevakumar K, Chandren JR, Perez-Perez GI, Chua EG, Teh LK, Salleh MZ, et al.

PLoS One, 2016;11(7):e0159830.
PMID: 27441568 DOI: 10.1371/journal.pone.0159830

The epidemiology of Helicobacter pylori (H. pylori) infection is related to human poverty with marked differences between developing and developed countries. Socioeconomic factors and living standards are the main determinants of the age-dependent acquisition rate of H. pylori, and consequently its prevalence. The aim of this study was to assess the risk and sero-prevalence of H. pylori colonization among Orang Asli in Peninsula Malaysia. This cross-sectional study was conducted on Orang Asli subjects in seven isolated settlements spanning across all three major tribes (Negrito, Proto Malay and Senoi) in Malaysia. Socio-demographic characteristics of the subjects were obtained through interview. Subjects were tested for H. pylori colonization based on CagA and whole cell (WC) antigen serological assays. A total of 275 subjects participated in this study. Among these subjects, 115 (44.7%) were H. pylori sero-positive with highest sero-prevalence among Negrito (65.7%). Among subjects who were H. pylori sero-positive, CagA sero positivity was also significantly higher among Negrito. The highest proportion of respondents reported to be H. pylori sero-positive was from age group 30 years old and below (57.9%), males (56.2%), Negrito (48.6%) and live in bamboo house (92.3%). The highest proportion of respondents reported to be CagA sero-positive was from age group 30 years old and below (41.4%), males (35.6%) and Negrito (48.6%). The results of this study demonstrate that H. pylori colonization can be related to age, gender, tribes and house materials and CagA sero-positive stain closely associated with age, gender and tribes.
Transfusion-dependent thalassemia in Northern Sarawak: a molecular study to identify different genotypes in the multi-ethnic groups and the importance of genomic sequencing in unstudied populations

Tan JA, Chin SS, Ong GB, Mohamed Unni MN, Soosay AE, Gudum HR, et al.

Public Health Genomics, 2015;18(1):60-4.
PMID: 25412720 DOI: 10.1159/000368342

BACKGROUND: Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak.
METHODS: Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing.
RESULTS: Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients.
CONCLUSION: The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations.
Fulltext A novel gap-PCR with high resolution melting analysis for the detection of α-thalassaemia Southeast Asian and Filipino β°-thalassaemia deletion

Kho SL, Chua KH, George E, Tan JA

Sci Rep, 2015;5:13937.
PMID: 26365497 DOI: 10.1038/srep13937

Homozygosity for the α-thalassaemia Southeast Asian (α-SEA) and Filipino β°-thalassaemia (β-FIL) deletions can cause serious complications leading to foetal death or life-long blood transfusions. A rapid and accurate molecular detection assay is essential in populations where the deletions are common. In this study, gap-polymerase chain reaction (PCR) with high resolution melting (HRM) analysis was developed to detect both the large deletions. Melting curves at 86.9 ± 0.1 °C were generated by normal individuals without the α-SEA deletion, 84.7 ± 0.1 °C by homozygous α-SEA deletion individuals and two melting curves at 84.7 ± 0.1 °C and 86.9 ± 0.1 °C by α-SEA deletion carriers. Normal individuals without the β-FIL deletion produce amplicons with a melting temperature (Tm) at 74.6 ± 0.1 °C, homozygous β-FIL individuals produce amplicons with Tm at 73.6 ± 0.1 °C and heterozygous β-FIL individuals generate two amplicons with Tm at 73.6 ± 0.1 °C and 74.6 ± 0.1 °C. Evaluation using blinded tests on 220 DNA samples showed 100% sensitivity and specificity. The developed assays are sensitive and specific for rapid molecular and prenatal diagnosis for the α-SEA and β-FIL deletions.
Fulltext DNA studies are necessary for accurate patient diagnosis in compound heterozygosity for Hb Adana (HBA2:c.179>A) with deletional or nondeletional α-thalassaemia

Tan JA, Kho SL, Ngim CF, Chua KH, Goh AS, Yeoh SL, et al.

Sci Rep, 2016 06 08;6:26994.
PMID: 27271331 DOI: 10.1038/srep26994

Haemoglobin (Hb) Adana (HBA2:c.179>A) interacts with deletional and nondeletional α-thalassaemia mutations to produce HbH disorders with varying clinical manifestations from asymptomatic to severe anaemia with significant hepatosplenomegaly. Hb Adana carriers are generally asymptomatic and haemoglobin subtyping is unable to detect this highly unstable α-haemoglobin variant. This study identified 13 patients with compound heterozygosity for Hb Adana with either the 3.7 kb gene deletion (-α(3.7)), Hb Constant Spring (HbCS) (HBA2:c.427T>C) or Hb Paksé (HBA2:429A>T). Multiplex Amplification Refractory Mutation System was used for the detection of five deletional and six nondeletional α-thalassaemia mutations. Duplex-PCR was used to confirm Hb Paksé and HbCS. Results showed 84.6% of the Hb Adana patients were Malays. Using DNA studies, compound heterozygosity for Hb Adana and HbCS (α(codon 59)α/α(CS)α) was confirmed in 11 patients. A novel point in this investigation was that DNA studies confirmed Hb Paksé for the first time in a Malaysian patient (α(codon 59)α/α(Paksé)α) after nine years of being misdiagnosis with Hb Adana and HbCS (α(codon 59)α/α(CS)α). Thus, the reliance on haematology studies and Hb subtyping to detect Hb variants is inadequate in countries where thalassaemia is prevalent and caused by a wide spectrum of mutations.
Fulltext High throughput molecular confirmation of β-thalassemia mutations using novel TaqMan probes

Kho SL, Chua KH, George E, Tan JA

Sensors (Basel), 2013;13(2):2506-14.
PMID: 23429513 DOI: 10.3390/s130202506

β-Thalassemia is a public health problem where 4.5% of Malaysians are β-thalassemia carriers. The genetic disorder is caused by defects in the β-globin gene complex which lead to reduced or complete absence of β-globin chain synthesis. Five TaqMan genotyping assays were designed and developed to detect the common β-thalassemia mutations in Malaysian Malays. The assays were evaluated with 219 "blinded" DNA samples and the results showed 100% sensitivity and specificity. The in-house designed TaqMan genotyping assays were found to be cost- and time-effective for characterization of β-thalassemia mutations in the Malaysian population.
Fulltext Mutation analysis of the BRCA1 gene in Malaysian breast cancer patients

Balraj P, Khoo AS, Volpi L, Tan JA, Nair S, Abdullah H

Singapore Med J, 2002 Apr;43(4):194-7.
PMID: 12188064

Thirty patients with early onset breast cancer or familial breast cancer from Malaysia were analysed for germline mutation in the early onset breast cancer I gene (BRCA1). Direct sequencing of the entire coding region of BRCA1 identified a frameshift mutation, c.5447-5448insC (insC5447) (codon 1776 of exon 21) in a patient aged 32 of the Malay ethnic origin, who had no family history of breast and/or ovarian cancer. Eight polymorphisms (2201C > T, 2430T > C, P871L, E1038G, K1183R, 4427T > C, S1613G and IVS8-57delT) were identified in the samples tested.
BamH1 polymorphism in the Chinese, Malays, and Indians in Singapore and its application in the prenatal diagnosis of beta-thalassemia

Tan JA, Tay SH, Kham KY, Wong HB

Jpn. J. Hum. Genet., 1993 Sep;38(3):315-8.
PMID: 7903173 DOI: 10.1007/BF01874141

The distribution of restriction fragment length polymorphism (RFLP) at the BamH1 site of the beta-globin gene was investigated in the Chinese, Indian, and Malay race in Singapore. The sample comprised of 183 normal individuals and 35 beta-thalassemia carriers in which 13 were couples with at least one beta-major child. The results from this study indicate that BamH1 polymorphism will be informative in 22% of pregnancies at risk for beta-thalassemia major in Chinese, 19% in Malays and 7% in Indians. In prenatal diagnosis using BamH1 polymorphism for one beta-major affected family, the fetus was diagnosed to be normal or beta-carrier. The validity of BamH1 polymorphism in the exclusion of beta-thalassemia major was subsequently confirmed at birth by globin chain biosynthesis.
Fulltext Molecular characterisation of Haemoglobin Constant Spring and Haemoglobin Quong Sze with a Combine-Amplification Refractory Mutation System

Wee YC, Tan KL, Chua KH, George E, Tan JA

Malays J Med Sci, 2009 Jul;16(3):21-8.
PMID: 22589661 MyJurnal

BACKGROUND: The interaction of the non-deletional α(+)-thalassaemia mutations Haemoglobin Constant Spring and Haemoglobin Quong Sze with the Southeast Asian double α-globin gene deletion results in non-deletional Haemoglobin H disease. Accurate detection of non-deletional Haemoglobin H disease, which is associated with severe phenotypes, is necessary as these mutations have been confirmed in the Malaysian population.
METHODS: DNA from two families with Haemoglobin H disease was extracted from EDTA-anticoagulated whole blood and subjected to molecular analysis for α-thalassaemia. A duplex polymerase chain reaction was used to detect the Southeast Asian α-globin gene deletion. Polymerase chain reaction-restriction fragment length polymorphism analysis was then carried out to determine the presence of Haemoglobin Constant Spring and Haemoglobin Quong Sze. A combine-amplification refractory mutation system protocol was optimised and implemented for the rapid and specific molecular characterisation of Haemoglobin Constant Spring and Haemoglobin Quong Sze in a single polymerase chain reaction.
RESULTS AND CONCLUSIONS: The combine-amplification refractory mutation system for Haemoglobin Constant Spring and Haemoglobin Quong Sze, together with the duplex polymerase chain reaction, provides accurate pre- and postnatal diagnosis of non-deletional Haemoglobin H disease and allows detailed genotype analyses using minimal quantities of DNA.
KEYWORDS: Combine-ARMS; Hb Constant Spring; Hb Quong Sze; medical sciences
Fulltext Molecular characterisation and frequency of Ggamma Xmn I polymorphism in Chinese and Malay beta-thalassaemia patients in Malaysia

Wong YC, George E, Tan KL, Yap SF, Chan LL, Tan JA

Malays J Pathol, 2006 Jun;28(1):17-21.
PMID: 17694955

The molecular basis of variable phenotypes in P-thalassaemia patients with identical genotypes has been associated with co-inheritance of alpha-thalassaemia and persistence of HbF production in adult life. The Xmn I restriction site at -158 position of the Ggamma-gene is associated with increased expression of the Ggamma-globin gene and higher production of HbF This study aims to determine the frequency of the digammaferent genotypes of the Ggamma Xmn I polymorphism in P-thalassaemia patients in two ethnic groups in Malaysia. Molecular characterisation and frequency of the Ggamma Xmn I polymorphism were studied in fifty-eight Chinese and forty-nine beta-thalassaemia Malay patients by Xmn I digestion after DNA amplification of a 650 bp sequence. The in-house developed technique did not require further purification or concentration of amplified DNA before restriction enzyme digestion. The cheaper Seakem LE agarose was used instead of Nusieve agarose and distinct well separated bands were observed. Genotyping showed that the most frequent genotype observed in the Malaysian Chinese was homozygosity for the absence of the Xmn I site (-/-) (89.7%). In the Malays, heterozygosity of the Xmn I site (+/-) was most common (63.3%). Homozygosity for the Xmn I site (+/+) was absent in the Chinese, but was confirmed in 8.2% of the Malays. The ratio of the (+) allele (presence of the Xmn I site) to the (-) allele (absence of the Xmn I site)) was higher in the Malays (0.66) compared to the Chinese (0.05). The (+/-) and (+/+) genotypes are more commonly observed in the Malays than the Chinese in Malaysia.

Filters

Please provide feedback to Administrator (afdal@afpm.org.my)

External Links