Displaying publications 7261 - 7280 of 8505 in total

Abstract:
Sort:
  1. Transfusion-dependent thalassemia in Northern Sarawak: a molecular study to identify different genotypes in the multi-ethnic groups and the importance of genomic sequencing in unstudied populations
    Tan JA, Chin SS, Ong GB, Mohamed Unni MN, Soosay AE, Gudum HR, et al.
    Public Health Genomics, 2015;18(1):60-4.
    PMID: 25412720 DOI: 10.1159/000368342
    BACKGROUND: Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak.
    METHODS: Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing.
    RESULTS: Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients.
    CONCLUSION: The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations.
  2. Fulltext Pictet-Spengler reaction-based biosynthetic machinery in fungi
    Yan W, Ge HM, Wang G, Jiang N, Mei YN, Jiang R, et al.
    Proc Natl Acad Sci U S A, 2014 Dec 23;111(51):18138-43.
    PMID: 25425666 DOI: 10.1073/pnas.1417304111
    The Pictet-Spengler (PS) reaction constructs plant alkaloids such as morphine and camptothecin, but it has not yet been noticed in the fungal kingdom. Here, a silent fungal Pictet-Spenglerase (FPS) gene of Chaetomium globosum 1C51 residing in Epinephelus drummondhayi guts is described and ascertained to be activable by 1-methyl-L-tryptophan (1-MT). The activated FPS expression enables the PS reaction between 1-MT and flavipin (fungal aldehyde) to form "unnatural" natural products with unprecedented skeletons, of which chaetoglines B and F are potently antibacterial with the latter inhibiting acetylcholinesterase. A gene-implied enzyme inhibition (GIEI) strategy has been introduced to address the key steps for PS product diversifications. In aggregation, the work designs and validates an innovative approach that can activate the PS reaction-based fungal biosynthetic machinery to produce unpredictable compounds of unusual and novel structure valuable for new biology and biomedicine.
  3. Fulltext A genome wide pattern of population structure and admixture in peninsular Malaysia Malays
    Hatin WI, Nur-Shafawati AR, Etemad A, Jin W, Qin P, Xu S, et al.
    Hugo J, 2014 Dec;8(1):5.
    PMID: 27090253 DOI: 10.1186/s11568-014-0005-z
    BACKGROUND: The Malays consist of various sub-ethnic groups which are believed to have different ancestral origins based on their migrations centuries ago. The sub-ethnic groups can be divided based on the region they inhabit; the northern (Melayu Kedah and Melayu Kelantan), western (Melayu Minang) and southern parts (Melayu Bugis and Melayu Jawa) of Peninsular Malaysia. We analyzed 54,794 autosomal single nucleotide polymorphisms (SNPs) which were shared by 472 unrelated individuals from 17 populations to determine the genetic structure and distributions of the ancestral genetic components in five Malay sub-ethnic groups namely Melayu Bugis, Melayu Jawa, Melayu Minang, Melayu Kedah, and Melayu Kelantan. We also have included in the analysis 12 other study populations from Thailand, Indonesia, China, India, Africa and Orang Asli sub-groups in Malay Peninsula, obtained from the Pan Asian SNP Initiative (PASNPI) Consortium and International HapMap project database.

    RESULTS: We found evidence of genetic influx from Indians to Malays, more in Melayu Kedah and Melayu Kelantan which are genetically different from the other Malay sub-ethnic groups, but similar to Thai Pattani. More than 98% of these northern Malays haplotypes could be found in either Indians or Chinese populations, indicating a highly admixture pattern among populations. Nevertheless, the ancestry lines of Malays, Indonesians and Thais were traced back to have shared a common ancestor with the Proto-Malays and Chinese.

    CONCLUSIONS: These results support genetic admixtures in the Peninsular Malaysia Malay populations and provided valuable information on the enigmatic demographical history as well as shed some insights into the origins of the Malays in the Malay Peninsula.

  4. Fulltext Molecular characterisation of the tick Rhipicephalus microplus in Malaysia: new insights into the cryptic diversity and distinct genetic assemblages throughout the world
    Low VL, Tay ST, Kho KL, Koh FX, Tan TK, Lim YA, et al.
    Parasit Vectors, 2015;8:341.
    PMID: 26104478 DOI: 10.1186/s13071-015-0956-5
    The morphotaxonomy of Rhipicephalus microplus complex has been challenged in the last few years and prompted many biologists to adopt a DNA-based method for distinguishing the members of this group. In the present study, we used a mitochondrial DNA analysis to characterise the genetic assemblages, population structure and dispersal pattern of R. microplus from Southeast Asia, the region where the species originated.
  5. Fulltext Cardiovascular Risk Factors and Ethnicity Are Independent Factors Associated with Lower Urinary Tract Symptoms
    Lim J, Bhoo-Pathy N, Sothilingam S, Malek R, Sundram M, Tan GH, et al.
    PLoS One, 2015;10(6):e0130820.
    PMID: 26098884 DOI: 10.1371/journal.pone.0130820
    To determine the lower urinary tract symptoms (LUTS) profile and factors affecting its degree of severity including cardiovascular risk profile, age, ethnicity, education level and prostate volume in a multiethnic Asian setting.
  6. Local configuration pattern features for age-related macular degeneration characterization and classification
    Mookiah MR, Acharya UR, Fujita H, Koh JE, Tan JH, Noronha K, et al.
    Comput Biol Med, 2015 Aug;63:208-18.
    PMID: 26093788 DOI: 10.1016/j.compbiomed.2015.05.019
    Age-related Macular Degeneration (AMD) is an irreversible and chronic medical condition characterized by drusen, Choroidal Neovascularization (CNV) and Geographic Atrophy (GA). AMD is one of the major causes of visual loss among elderly people. It is caused by the degeneration of cells in the macula which is responsible for central vision. AMD can be dry or wet type, however dry AMD is most common. It is classified into early, intermediate and late AMD. The early detection and treatment may help one to stop the progression of the disease. Automated AMD diagnosis may reduce the screening time of the clinicians. In this work, we have introduced LCP to characterize normal and AMD classes using fundus images. Linear Configuration Coefficients (CC) and Pattern Occurrence (PO) features are extracted from fundus images. These extracted features are ranked using p-value of the t-test and fed to various supervised classifiers viz. Decision Tree (DT), Nearest Neighbour (k-NN), Naive Bayes (NB), Probabilistic Neural Network (PNN) and Support Vector Machine (SVM) to classify normal and AMD classes. The performance of the system is evaluated using both private (Kasturba Medical Hospital, Manipal, India) and public domain datasets viz. Automated Retinal Image Analysis (ARIA) and STructured Analysis of the Retina (STARE) using ten-fold cross validation. The proposed approach yielded best performance with a highest average accuracy of 97.78%, sensitivity of 98.00% and specificity of 97.50% for STARE dataset using 22 significant features. Hence, this system can be used as an aiding tool to the clinicians during mass eye screening programs to diagnose AMD.
  7. Antithrombotic treatment for stroke prevention in atrial fibrillation: The Asian agenda
    Chen CH, Chen MC, Gibbs H, Kwon SU, Lo S, On YK, et al.
    Int J Cardiol, 2015 Jul 15;191:244-53.
    PMID: 25978611 DOI: 10.1016/j.ijcard.2015.03.369
    Atrial fibrillation (AF) is the most common heart arrhythmia. Untreated AF incurs a considerable burden of stroke and associated healthcare costs. Asians have AF risk factors similar to Caucasians and a similarly increased risk of AF-related stroke; however, with a vast and rapidly ageing population, Asia bears a disproportionately large disease burden. Urgent action is warranted to avert this potential health crisis. Antithrombotic therapy with oral anticoagulants is the most effective means of preventing stroke in AF and is a particular priority in Asia given the increasing disease burden. However, AF in Asia remains undertreated. Conventional oral anticoagulation with warfarin is problematic in Asia due to suboptimal control and a propensity among Asians to warfarin-induced intracranial haemorrhage. Partly due to concerns about intracranial haemorrhage, there are considerable gaps between AF treatment guidelines and clinical practice in Asia, in particular overuse of antiplatelet agents and underuse of anticoagulants. Compared with warfarin, new direct thrombin inhibitors and Factor Xa inhibitors are non-inferior in preventing stroke and significantly reduce the risk of life-threatening bleeding, particularly intracranial bleeding. These agents may therefore provide an appropriate alternative to warfarin in Asian patients. There is considerable scope to improve stroke prevention in AF in Asia. Key priorities include: early detection of AF and identification of asymptomatic patients; assessment of stroke and bleeding risk for all AF patients; evidence-based pharmacotherapy with direct-acting oral anticoagulant agents or vitamin K antagonists for AF patients at risk of stroke; controlling hypertension; and awareness-raising, education and outreach among both physicians and patients.
  8. Patterns and Risk Factors of Soil-Transmitted Helminthiasis Among Orang Asli Subgroups in Peninsular Malaysia
    Ngui R, Aziz S, Chua KH, Aidil RM, Lee SC, Tan TK, et al.
    Am J Trop Med Hyg, 2015 Aug;93(2):361-70.
    PMID: 26055746 DOI: 10.4269/ajtmh.13-0677
    A cross-sectional study was conducted to provide comprehensive data on the patterns and associated risk factors of soil-transmitted helminth (STH) infections among five Orang Asli subgroups in Peninsular Malaysia. The overall prevalence of STH infections was 59.9% (95% confidence interval [CI] = 56.1-63.7%). Trichuris trichiura (54.3%; 95% CI = 50.4-58.2%) was the predominant species followed by Ascaris lumbricoides (26.7%; 95% CI = 23.3-30.1%) and hookworm (9.1%; 95% CI = 6.9-11.3%). This study showed diversity for STH infections by subgroup with poverty and personal sanitary behavior as important risk factors for infection. Risk profile analyses indicating that Orang Kuala subgroup who has a generally well-developed infrastructure and better quality of life had a low rate of infection. There is a need for poverty reduction and promotion of deworming programs along with mass scale campaigns to create awareness about health and hygiene to reduce STH infections.
  9. Concurrent loss of co-stimulatory molecules and functional cytokine secretion attributes leads to proliferative senescence of CD8(+) T cells in HIV/TB co-infection
    Saeidi A, Chong YK, Yong YK, Tan HY, Barathan M, Rajarajeswaran J, et al.
    Cell Immunol, 2015 Sep;297(1):19-32.
    PMID: 26071876 DOI: 10.1016/j.cellimm.2015.05.005
    The role of T-cell immunosenescence and functional CD8(+) T-cell responses in HIV/TB co-infection is unclear. We examined and correlated surrogate markers of HIV disease progression with immune activation, immunosenescence and differentiation using T-cell pools of HIV/TB co-infected, HIV-infected and healthy controls. Our investigations showed increased plasma viremia and reduced CD4/CD8 T-cell ratio in HIV/TB co-infected subjects relative to HIV-infected, and also a closer association with changes in the expression of CD38, a cyclic ADP ribose hydrolase and CD57, which were consistently expressed on late-senescent CD8(+) T cells. Up-regulation of CD57 and CD38 were directly proportional to lack of co-stimulatory markers on CD8(+) T cells, besides diminished expression of CD127 (IL-7Rα) on CD57(+)CD4(+) T cells. Notably, intracellular IFN-γ, perforin and granzyme B levels in HIV-specific CD8(+) T cells of HIV/TB co-infected subjects were diminished. Intracellular CD57 levels in HIV gag p24-specific CD8(+) T cells were significantly increased in HIV/TB co-infection. We suggest that HIV-TB co-infection contributes to senescence associated with chronic immune activation, which could be due to functional insufficiency of CD8(+) T cells.
  10. In(x)Ga(1-x)As nanowires with uniform composition, pure wurtzite crystal phase and taper-free morphology
    Ameruddin AS, Fonseka HA, Caroff P, Wong-Leung J, Op het Veld RL, Boland JL, et al.
    Nanotechnology, 2015 May 22;26(20):205604.
    PMID: 25927420 DOI: 10.1088/0957-4484/26/20/205604
    Obtaining compositional homogeneity without compromising morphological or structural quality is one of the biggest challenges in growing ternary alloy compound semiconductor nanowires. Here we report growth of Au-seeded InxGa1-xAs nanowires via metal-organic vapour phase epitaxy with uniform composition, morphology and pure wurtzite (WZ) crystal phase by carefully optimizing growth temperature and V/III ratio. We find that high growth temperatures allow the InxGa1-xAs composition to be more uniform by suppressing the formation of typically observed spontaneous In-rich shells. A low V/III ratio results in the growth of pure WZ phase InxGa1-xAs nanowires with uniform composition and morphology while a high V/III ratio allows pure zinc-blende (ZB) phase to form. Ga incorporation is found to be dependent on the crystal phase favouring higher Ga concentration in ZB phase compared to the WZ phase. Tapering is also found to be more prominent in defective nanowires hence it is critical to maintain the highest crystal structure purity in order to minimize tapering and inhomogeneity. The InP capped pure WZ In0.65Ga0.35As core-shell nanowire heterostructures show 1.54 μm photoluminescence, close to the technologically important optical fibre telecommunication wavelength, which is promising for application in photodetectors and nanoscale lasers.
  11. Fulltext Activation of the kynurenine pathway and increased production of the excitotoxin quinolinic acid following traumatic brain injury in humans
    Yan EB, Frugier T, Lim CK, Heng B, Sundaram G, Tan M, et al.
    J Neuroinflammation, 2015 May 30;12:110.
    PMID: 26025142 DOI: 10.1186/s12974-015-0328-2
    During inflammation, the kynurenine pathway (KP) metabolises the essential amino acid tryptophan (TRP) potentially contributing to excitotoxicity via the release of quinolinic acid (QUIN) and 3-hydroxykynurenine (3HK). Despite the importance of excitotoxicity in the development of secondary brain damage, investigations on the KP in TBI are scarce. In this study, we comprehensively characterised changes in KP activation by measuring numerous metabolites in cerebrospinal fluid (CSF) from TBI patients and assessing the expression of key KP enzymes in brain tissue from TBI victims. Acute QUIN levels were further correlated with outcome scores to explore its prognostic value in TBI recovery.

    METHODS: Twenty-eight patients with severe TBI (GCS ≤ 8, three patients had initial GCS = 9-10, but rapidly deteriorated to ≤8) were recruited. CSF was collected from admission to day 5 post-injury. TRP, kynurenine (KYN), kynurenic acid (KYNA), QUIN, anthranilic acid (AA) and 3-hydroxyanthranilic acid (3HAA) were measured in CSF. The Glasgow Outcome Scale Extended (GOSE) score was assessed at 6 months post-TBI. Post-mortem brains were obtained from the Australian Neurotrauma Tissue and Fluid Bank and used in qPCR for quantitating expression of KP enzymes (indoleamine 2,3-dioxygenase-1 (IDO1), kynurenase (KYNase), kynurenine amino transferase-II (KAT-II), kynurenine 3-monooxygenase (KMO), 3-hydroxyanthranilic acid oxygenase (3HAO) and quinolinic acid phosphoribosyl transferase (QPRTase) and IDO1 immunohistochemistry.

    RESULTS: In CSF, KYN, KYNA and QUIN were elevated whereas TRP, AA and 3HAA remained unchanged. The ratios of QUIN:KYN, QUIN:KYNA, KYNA:KYN and 3HAA:AA revealed that QUIN levels were significantly higher than KYN and KYNA, supporting increased neurotoxicity. Amplified IDO1 and KYNase mRNA expression was demonstrated on post-mortem brains, and enhanced IDO1 protein coincided with overt tissue damage. QUIN levels in CSF were significantly higher in patients with unfavourable outcome and inversely correlated with GOSE scores.

    CONCLUSION: TBI induced a striking activation of the KP pathway with sustained increase of QUIN. The exceeding production of QUIN together with increased IDO1 activation and mRNA expression in brain-injured areas suggests that TBI selectively induces a robust stimulation of the neurotoxic branch of the KP pathway. QUIN's detrimental roles are supported by its association to adverse outcome potentially becoming an early prognostic factor post-TBI.

  12. Inhibition of palm oil oxidation by zeolite nanocrystals
    Tan KH, Awala H, Mukti RR, Wong KL, Rigaud B, Ling TC, et al.
    J Agric Food Chem, 2015 May 13;63(18):4655-63.
    PMID: 25897618 DOI: 10.1021/acs.jafc.5b00380
    The efficiency of zeolite X nanocrystals (FAU-type framework structure) containing different extra-framework cations (Li(+), Na(+), K(+), and Ca(2+)) in slowing the thermal oxidation of palm oil is reported. The oxidation study of palm oil is conducted in the presence of zeolite nanocrystals (0.5 wt %) at 150 °C. Several characterization techniques such as visual analysis, colorimetry, rheometry, total acid number (TAN), FT-IR spectroscopy, (1)H NMR spectroscopy, and Karl Fischer analyses are applied to follow the oxidative evolution of the oil. It was found that zeolite nanocrystals decelerate the oxidation of palm oil through stabilization of hydroperoxides, which are the primary oxidation product, and concurrently via adsorption of the secondary oxidation products (alcohols, aldehydes, ketones, carboxylic acids, and esters). In addition to the experimental results, periodic density functional theory (DFT) calculations are performed to elucidate further the oxidation process of the palm oil in the presence of zeolite nanocrystals. The DFT calculations show that the metal complexes formed with peroxides are more stable than the complexes with alkenes with the same ions. The peroxides captured in the zeolite X nanocrystals consequently decelerate further oxidation toward formation of acids. Unlike the monovalent alkali metal cations in the zeolite X nanocrystals (K(+), Na(+), and Li(+)), Ca(2+) reduced the acidity of the oil by neutralizing the acidic carboxylate compounds to COO(-)(Ca(2+))1/2 species.
  13. Fulltext Differential modulation of immune response and cytokine profiles in the bursae and spleen of chickens infected with very virulent infectious bursal disease virus
    Rasoli M, Yeap SK, Tan SW, Roohani K, Kristeen-Teo YW, Alitheen NB, et al.
    BMC Vet Res, 2015;11:75.
    PMID: 25884204 DOI: 10.1186/s12917-015-0377-x
    Very virulent infectious bursal disease virus (vvIBDV) induces immunosuppression and inflammation in young birds, which subsequently leads to high mortality. In addition, infectious bursal disease (IBD) is one of the leading causes of vaccine failure on farms. Therefore, understanding the immunopathogenesis of IBDV in both the spleen and the bursae could help effective vaccine development. However, previous studies only profiled the differential expression of a limited number of cytokines, in either the spleen or the bursae of Fabricius of IBDV-infected chickens. Thus, this study aims to evaluate the in vitro and in vivo immunoregulatory effects of vvIBDV infection on macrophage-like cells, spleen and bursae of Fabricius.
  14. Association of BDNF Polymorphisms with the Risk of Epilepsy: a Multicenter Study
    Sha'ari HM, Haerian BS, Baum L, Tan HJ, Rafia MH, Kwan P, et al.
    Mol Neurobiol, 2016 07;53(5):2869-2877.
    PMID: 25876511 DOI: 10.1007/s12035-015-9150-1
    Epilepsy is a common neurological disease characterized by recurrent unprovoked seizures. Evidence suggested that abnormal activity of brain-derived neurotrophic factor (BDNF) contributes to the pathogenesis of epilepsy. Some previous studies identified association between genetic variants of BDNF and risk of epilepsy. In this study, this association has been examined in the Hong Kong and Malaysian epilepsy cohorts. Genomic DNA of 6047 subjects (1640 patients with epilepsy and 4407 healthy individuals) was genotyped for rs6265, rs11030104, rs7103411, and rs7127507 polymorphisms by using Sequenom MassArray and Illumina HumanHap 610-Quad or 550-Duo BeadChip arrays techniques. Results showed significant association between rs6265 T, rs7103411 C, and rs7127507 T and cryptgenic epilepsy risk (p = 0.00003, p = 0.0002, and p = 0.002, respectively) or between rs6265 and rs7103411 and symptomatic epilepsy risk in Malaysian Indians (TT vs. CC, p = 0.004 and T vs. C, p = 0.0002, respectively) as well as between rs6265 T and risk of cryptogenic epilepsy in Malaysian Chinese (p = 0.005). The Trs6265-Crs7103411-Trs7127507 was significantly associated with cryptogenic epilepsy in Malaysian Indians (p = 0.00005). In conclusion, our results suggest that BDNF polymorphisms might contribute to the risk of epilepsy in Malaysian Indians and Chinese.
  15. Fulltext Synthesis of an anthraquinone derivative (DHAQC) and its effect on induction of G2/M arrest and apoptosis in breast cancer MCF-7 cell line
    Yeap S, Akhtar MN, Lim KL, Abu N, Ho WY, Zareen S, et al.
    Drug Des Devel Ther, 2015;9:983-92.
    PMID: 25733816 DOI: 10.2147/DDDT.S65468
    Anthraquinones are an important class of naturally occurring biologically active compounds. In this study, anthraquinone derivative 1,3-dihydroxy-9,10-anthraquinone-2- carboxylic acid (DHAQC) (2) was synthesized with 32% yield through the Friedel-Crafts condensation reaction. The mechanisms of cytotoxicity of DHAQC (2) in human breast cancer MCF-7 cells were further investigated. Results from the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay showed that DHAQC (2) exhibited potential cytotoxicity and selectivity in the MCF-7 cell line, comparable with the naturally occurring anthraquinone damnacanthal. DHAQC (2) showed a slightly higher IC50 (inhibitory concentration with 50% cell viability) value in the MCF-7 cell line compared to damnacanthal, but it is more selective in terms of the ratio of IC50 on MCF-7 cells and normal MCF-10A cells. (selective index for DHAQC (2) was 2.3 and 1.7 for damnacanthal). The flow cytometry cell cycle analysis on the MCF-7 cell line treated with the IC50 dose of DHAQC (2) for 48 hours showed that DHAQC (2) arrested MCF-7 cell line at the G2/M phase in association with an inhibited expression of PLK1 genes. Western blot analysis also indicated that the DHAQC (2) increased BAX, p53, and cytochrome c levels in MCF-7 cells, which subsequently activated apoptosis as observed in annexin V/propidium iodide and cell cycle analyses. These results indicate that DHAQC (2) is a synthetic, cytotoxic, and selective anthraquinone, which is less toxic than the natural product damnacanthal, and which demonstrates potential in the induction of apoptosis in the breast cancer MCF-7 cell line.
  16. Fulltext Helicobacter pylori infection can affect energy modulating hormones and body weight in germ free mice
    Khosravi Y, Seow SW, Amoyo AA, Chiow KH, Tan TL, Wong WY, et al.
    Sci Rep, 2015;5:8731.
    PMID: 25736205 DOI: 10.1038/srep08731
    Helicobacter pylori, is an invariably commensal resident of the gut microbiome associated with gastric ulcer in adults. In addition, these patients also suffered from a low grade inflammation that activates the immune system and thus increased shunting of energy to host defense mechanisms. To assess whether a H. pylori infection could affect growth in early life, we determined the expression levels of selected metabolic gut hormones in germ free (GF) and specific pathogen-free (SPF) mice with and without the presence of H. pylori. Despite H. pylori-infected (SPFH) mice display alteration in host metabolism (elevated levels of leptin, insulin and peptide YY) compared to non-infected SPF mice, their growth curves remained the same. SPFH mice also displayed increased level of eotaxin-1. Interestingly, GF mice infected with H. pylori (GFH) also displayed increased levels of ghrelin and PYY. However, in contrast to SPFH mice, GFH showed reduced weight gain and malnutrition. These preliminary findings show that exposure to H. pylori alters host metabolism early in life; but the commensal microbiota in SPF mice can attenuate the growth retarding effect from H. pylori observed in GF mice. Further investigations of possible additional side effects of H. pylori are highly warranted.
  17. Fulltext YersiniaBase: a genomic resource and analysis platform for comparative analysis of Yersinia
    Tan SY, Dutta A, Jakubovics NS, Ang MY, Siow CC, Mutha NV, et al.
    BMC Bioinformatics, 2015;16:9.
    PMID: 25591325 DOI: 10.1186/s12859-014-0422-y
    Yersinia is a Gram-negative bacteria that includes serious pathogens such as the Yersinia pestis, which causes plague, Yersinia pseudotuberculosis, Yersinia enterocolitica. The remaining species are generally considered non-pathogenic to humans, although there is evidence that at least some of these species can cause occasional infections using distinct mechanisms from the more pathogenic species. With the advances in sequencing technologies, many genomes of Yersinia have been sequenced. However, there is currently no specialized platform to hold the rapidly-growing Yersinia genomic data and to provide analysis tools particularly for comparative analyses, which are required to provide improved insights into their biology, evolution and pathogenicity.
  18. Fulltext The impact of dyspepsia on symptom severity and quality of life in adults with headache
    Tai ML, Norhatta N, Goh KJ, Moy FM, Sujarita R, Asraff AA, et al.
    PLoS One, 2015;10(1):e0115838.
    PMID: 25629323 DOI: 10.1371/journal.pone.0115838
    BACKGROUND: Dyspepsia and headache frequently co-exist, but the clinical implication of this association is uncertain. We planned to examine the prevalence and impact of dyspepsia in adults with headache.
    METHODS: A cross-sectional study was conducted in a secondary care setting. Clinical, psychological and health-related quality of life (HRQOL) data were compared between subjects with headache and controls (non-headache subjects). The impact of dyspepsia was analysed further in subjects with headache alone.
    RESULTS: 280 subjects (93 cases with headache and 187 matched controls) were recruited. The following baseline characteristics of subjects were as follows: mean age 45.0 ± 17.3 years, 57.0% females and ethnic distribution-Malaysian = 45 (48.4%), Chinese n = 24 (25.8%) and Indians n = 24 (25.8%). Headache sub-types among cases with headache were as follows: tension-type headache (TTH) n = 53 (57.0%) and migraine n = 40 (43.0%). Dyspepsia was more prevalent in cases with headache compared to controls (25.8% vs 12.8%, p = 0.011), and headache was independently associated with dyspepsia (OR 2.75, 95% CI 1.39-5.43). Among cases with headache, there was a trend towards a higher prevalence of dyspepsia in those with migraine (27.5%) compared to TTH (24.5%). Subjects with headache and dyspepsia, compared to those with headache alone, had a greater severity of headache symptoms (63.67 ± 22.85 mm vs 51.20 ± 24.0 mm VAS, p = 0.029). Overall HRQOL scores were lower in headache subjects with dyspepsia (EQ-5D summary score 0.82 ± 0.18 vs 0.90 ± 0.16, p = 0.037 and EQ-5D VAS 62.08 ± 17.50 mm vs 72.62 ± 18.85 mm, p = 0.018), compared to those without dyspepsia.
    CONCLUSION: Dyspepsia is associated with more severe headache symptoms and results in a lower HRQOL in patients with headache.
  19. Fulltext Antioxidant effects of pineapple vinegar in reversing of paracetamol-induced liver damage in mice
    Mohamad NE, Yeap SK, Lim KL, Yusof HM, Beh BK, Tan SW, et al.
    Chin Med, 2015;10:3.
    PMID: 25699088 DOI: 10.1186/s13020-015-0030-4
    Pineapple (Ananas comosus) was demonstrated to be hepatoprotective. This study aims to investigate the reversing effects of pineapple vinegar on paracetamol-induced liver damage in murine model.
  20. Fulltext Early detection of dengue virus by use of reverse transcription-recombinase polymerase amplification
    Teoh BT, Sam SS, Tan KK, Danlami MB, Shu MH, Johari J, et al.
    J Clin Microbiol, 2015 Mar;53(3):830-7.
    PMID: 25568438 DOI: 10.1128/JCM.02648-14
    A method for the rapid diagnosis of early dengue virus (DENV) infection is highly needed. Here, a prototype reverse transcription-recombinase polymerase amplification (RT-RPA) assay was developed. The assay detected DENV RNA in <20 min without the need for thermocycling amplification. The assay enabled the detection of as few as 10 copies of DENV RNA. The designed RT-RPA primers and exo probe detected the DENV genome of at least 12 genotypes of DENV circulating globally without cross-reacting with other arboviruses. We assessed the diagnostic performance of the RT-RPA assay for the detection of DENV RNA in 203 serum samples of patients with clinically suspected dengue. The sera were simultaneously tested for DENV using a reverse transcription-loop-mediated isothermal amplification (RT-LAMP) assay, quantitative RT-PCR (qRT-PCR), and IgM- and IgG-capture enzyme-linked immunosorbent assays (ELISA). Acute DENV infection was confirmed in 130 samples and 61 of the samples (46.9%) were classified as viremic with qRT-PCR. The RT-RPA assay showed good concordance (κ of ≥0.723) with the RT-LAMP and qRT-PCR assays in detecting the dengue viremic samples. When used in combination with ELISA, both the RT-RPA and RT-LAMP assays increased the detection of acute DENV infection to ≥95.7% (≥45/47) in samples obtained within 5 days of illness. The results from the study suggest that the RT-RPA assay is the most rapid molecular diagnostic tool available for the detection of DENV. Hence, it is possible to use the RT-RPA assay in a laboratory to complement routine serology testing for dengue.
Related Terms
Filters
Contact Us

Please provide feedback to Administrator (afdal@afpm.org.my)

External Links