Displaying publications 861 - 880 of 8276 in total

Abstract:
Sort:
  1. Fulltext Confirmation of five novel susceptibility loci for systemic lupus erythematosus (SLE) and integrated network analysis of 82 SLE susceptibility loci
    Molineros JE, Yang W, Zhou XJ, Sun C, Okada Y, Zhang H, et al.
    Hum Mol Genet, 2017 03 15;26(6):1205-1216.
    PMID: 28108556 DOI: 10.1093/hmg/ddx026
    We recently identified ten novel SLE susceptibility loci in Asians and uncovered several additional suggestive loci requiring further validation. This study aimed to replicate five of these suggestive loci in a Han Chinese cohort from Hong Kong, followed by meta-analysis (11,656 cases and 23,968 controls) on previously reported Asian and European populations, and to perform bioinformatic analyses on all 82 reported SLE loci to identify shared regulatory signatures. We performed a battery of analyses for these five loci, as well as joint analyses on all 82 SLE loci. All five loci passed genome-wide significance: MYNN (rs10936599, Pmeta = 1.92 × 10-13, OR = 1.14), ATG16L2 (rs11235604, Pmeta = 8.87 × 10 -12, OR = 0.78), CCL22 (rs223881, Pmeta = 5.87 × 10-16, OR = 0.87), ANKS1A (rs2762340, Pmeta = 4.93 × 10-15, OR = 0.87) and RNASEH2C (rs1308020, Pmeta = 2.96 × 10-19, OR = 0.84) and co-located with annotated gene regulatory elements. The novel loci share genetic signatures with other reported SLE loci, including effects on gene expression, transcription factor binding, and epigenetic characteristics. Most (56%) of the correlated (r2 > 0.8) SNPs from the 82 SLE loci were implicated in differential expression (9.81 × 10-198 
    Matched MeSH terms: Gene Expression Regulation/genetics; Lupus Erythematosus, Systemic/genetics*; Ribonuclease H/genetics; Polymorphism, Single Nucleotide/genetics; Adaptor Proteins, Signal Transducing/genetics; Kruppel-Like Transcription Factors/genetics; Chemokine CCL22/genetics; Autophagy-Related Proteins/genetics
  2. Blood-based dynamic genomic signature for obsessive-compulsive disorder
    Wang Y, Cheng C, Zhang Z, Wang J, Wang Y, Li X, et al.
    Am J Med Genet B Neuropsychiatr Genet, 2018 12;177(8):709-716.
    PMID: 30350918 DOI: 10.1002/ajmg.b.32675
    No biologically based diagnostic criteria are in clinical use today for obsessive-compulsive disorder (OCD), schizophrenia, and major depressive disorder (MDD), which are defined with reference to Diagnostic and Statistical Manual clinical symptoms alone. However, these disorders cannot always be well distinguished on clinical grounds and may also be comorbid. A biological blood-based dynamic genomic signature that can differentiate among OCD, MDD, and schizophrenia would therefore be of great utility. This study enrolled 77 patients with OCD, 67 controls with no psychiatric illness, 39 patients with MDD, and 40 with schizophrenia. An OCD-specific gene signature was identified using blood gene expression analysis to construct a predictive model of OCD that can differentiate this disorder from healthy controls, MDD, and schizophrenia using a logistic regression algorithm. To verify that the genes selected were not derived as a result of chance, the algorithm was tested twice. First, the algorithm was used to predict the cohort with true disease/control status and second, the algorithm predicted the cohort with disease/control status randomly reassigned (null set). A six-gene panel (COPS7A, FKBP1A, FIBP, TP73-AS1, SDF4, and GOLGA8A) discriminated patients with OCD from healthy controls, MDD, and schizophrenia in the training set (with an area under the receiver-operating-characteristic curve of 0.938; accuracy, 86%; sensitivity, 88%; and specificity, 85%). Our findings indicate that a blood transcriptomic signature can distinguish OCD from healthy controls, MDD, and schizophrenia. This finding further confirms the feasibility of using dynamic blood-based genomic signatures in psychiatric disorders and may provide a useful tool for clinical staff engaged in OCD diagnosis and decision making.
    Matched MeSH terms: Calcium-Binding Proteins/genetics; Carrier Proteins/genetics; Glycoproteins/genetics; Membrane Proteins/genetics; Obsessive-Compulsive Disorder/genetics*; Transcription Factors/genetics; Tacrolimus Binding Proteins/genetics; Tumor Suppressor Proteins/genetics
  3. In silico 'fishing' using known small regulatory RNA (sRNA) candidates as the decoy from Escherichia coli, Salmonella typhi and Salmonella typhimurium manifested 14 novel sRNA candidates in the orthologous region of Proteus mirabilis
    KishanRaj S, Sumitha S, Siventhiran B, Thiviyaa O, Sathasivam KV, Xavier R, et al.
    Mol Biol Rep, 2018 Dec;45(6):2333-2343.
    PMID: 30284142 DOI: 10.1007/s11033-018-4397-z
    Proteus mirabilis, a gram-negative bacterium of the family Enterobacteriaceae, is a leading cause of urinary tract infection (UTI) with rapid development of multi-drug resistance. Identification of small regulatory RNAs (sRNAs), which belongs to a class of RNAs that do not translate into a protein, could permit the comprehension of the regulatory roles this molecules play in mediating pathogenesis and multi-drug resistance of the organism. In this study, comparative sRNA analysis across three different members of Enterobacteriaceae (Escherichia coli, Salmonella typhi and Salmonella typhimurium) was carried out to identify the sRNA homologs in P. mirabilis. A total of 232 sRNA genes that were reported in E. coli, S. typhi and S. typhimurium were subjected to comparative analysis against P. mirabilis HI4320 genome. We report the detection of 14 sRNA candidates, conserved in the orthologous regions of P. mirabilis, that are not included in Rfam database. Northern-blot analysis was carried out for selected three sRNA candidates from the current investigation and three known sRNA from Rfam of P. mirabilis. The expression pattern of the six sRNA candidates shows that they are growth stage-dependant. To the best of our knowledge, this is the first report on the identification of sRNA candidates in P. mirabilis.
    Matched MeSH terms: Escherichia coli/genetics; Proteus mirabilis/genetics*; RNA, Bacterial/genetics; Salmonella typhi/genetics; Salmonella typhimurium/genetics; Gene Expression Regulation, Bacterial/genetics; Genome, Bacterial/genetics; RNA, Small Untranslated/genetics*
  4. Fulltext Contribution of Genetic Polymorphisms of Inflammation Response Genes on Sporadic Colorectal Cancer Predisposition Risk in Malaysian Patients - A Case Control Study
    Ankathil R, Mustapha MA, Abdul Aziz AA, Mohd Shahpudin SN, Zakaria AD, Abu Hassan MR, et al.
    Asian Pac J Cancer Prev, 2019 06 01;20(6):1621-1632.
    PMID: 31244280 DOI: 10.31557/APJCP.2019.20.6.1621
    AIM: To investigate the frequencies and association of polymorphic genotypes of IL-8 -251 T>A, TNF-α -308
    G>A, ICAM-1 K469E, ICAM-1 R241G, IL-6 -174 G>C, and PPAR-γ 34 C>G in modulating susceptibility risk in
    Malaysian colorectal cancer (CRC) patients. Methods: In this case-control study, peripheral blood samples of 560
    study subjects (280 CRC patients and 280 controls) were collected, DNA extracted and genotyped using PCR-RFLP
    and Allele Specific PCR. The association between polymorphic genotype and CRC susceptibility risk was determined
    using Logistic Regression analysis deriving Odds ratio (OR) and 95% CI. Results: On comparing the frequencies of
    genotypes of all single nucleotide polymorphisms ( SNPs ) in patients and controls, the homozygous variant genotypes
    IL-8 -251 AA and TNF-α -308 AA and variant A alleles were significantly higher in CRC patients. Investigation on
    the association of the variant alleles and genotypes singly, with susceptibility risk showed the homozygous variant A
    alleles and genotypes IL-8 -251 AA and TNF-α -308 AA to be at higher risk for CRC predisposition. Analysis based
    on age, gender and smoking habits showed that the polymorphisms IL8 -251 T>A and TNF – α 308 G>A contribute
    to a significantly higher risk among male and female who are more than 50 years and for smokers in this population.
    Conclusion: We observed an association between variant allele and genotypes of IL-8-251 T>A and TNF-α-308
    G>A polymorphisms and CRC susceptibility risk in Malaysian patients. These two SNPs in inflammatory response
    genes which undoubtedly contribute to individual risks to CRC susceptibility may be considered as potential genetic
    predisposition factors for CRC in Malaysian population.
    Matched MeSH terms: Inflammation/genetics*; Biomarkers, Tumor/genetics*; Tumor Necrosis Factor-alpha/genetics; Colorectal Neoplasms/genetics*; Interleukin-6/genetics; Interleukin-8/genetics; Intercellular Adhesion Molecule-1/genetics; PPAR gamma/genetics
  5. Fulltext Oxidative stress-induced chromosome breaks within the ABL gene: a model for chromosome rearrangement in nasopharyngeal carcinoma
    Tan SN, Sim SP, Khoo AS
    Hum Genomics, 2018 06 18;12(1):29.
    PMID: 29914565 DOI: 10.1186/s40246-018-0160-8
    BACKGROUND: The mechanism underlying chromosome rearrangement in nasopharyngeal carcinoma (NPC) remains elusive. It is known that most of the aetiological factors of NPC trigger oxidative stress. Oxidative stress is a potent apoptotic inducer. During apoptosis, chromatin cleavage and DNA fragmentation occur. However, cells may undergo DNA repair and survive apoptosis. Non-homologous end joining (NHEJ) pathway has been known as the primary DNA repair system in human cells. The NHEJ process may repair DNA ends without any homology, although region of microhomology (a few nucleotides) is usually utilised by this DNA repair system. Cells that evade apoptosis via erroneous DNA repair may carry chromosomal aberration. Apoptotic nuclease was found to be associated with nuclear matrix during apoptosis. Matrix association region/scaffold attachment region (MAR/SAR) is the binding site of the chromosomal DNA loop structure to the nuclear matrix. When apoptotic nuclease is associated with nuclear matrix during apoptosis, it potentially cleaves at MAR/SAR. Cells that survive apoptosis via compromised DNA repair may carry chromosome rearrangement contributing to NPC tumourigenesis. The Abelson murine leukaemia (ABL) gene at 9q34 was targeted in this study as 9q34 is a common region of loss in NPC. This study aimed to identify the chromosome breakages and/or rearrangements in the ABL gene in cells undergoing oxidative stress-induced apoptosis.

    RESULTS: In the present study, in silico prediction of MAR/SAR was performed in the ABL gene. More than 80% of the predicted MAR/SAR sites are closely associated with previously reported patient breakpoint cluster regions (BCR). By using inverse polymerase chain reaction (IPCR), we demonstrated that hydrogen peroxide (H2O2)-induced apoptosis in normal nasopharyngeal epithelial and NPC cells led to chromosomal breakages within the ABL BCR that contains a MAR/SAR. Intriguingly, we detected two translocations in H2O2-treated cells. Region of microhomology was found at the translocation junctions. This observation is consistent with the operation of microhomology-mediated NHEJ.

    CONCLUSIONS: Our findings suggested that oxidative stress-induced apoptosis may participate in chromosome rearrangements of NPC. A revised model for oxidative stress-induced apoptosis mediating chromosome rearrangement in NPC is proposed.

    Matched MeSH terms: Chromosomes/genetics; DNA Repair/genetics; DNA-Binding Proteins/genetics; Oncogene Proteins v-abl/genetics*; Apoptosis/genetics; Oxidative Stress/genetics*; Matrix Attachment Regions/genetics*; DNA End-Joining Repair/genetics
  6. Lipocalin-2 is associated with modulation of disease phenotype in a patient with concurrent JAK2-V617F and BCR-ABL mutation
    Nadarajan VS, Ang CH, Bee PC
    Eur J Haematol, 2012 Feb;88(2):175-8.
    PMID: 21950422 DOI: 10.1111/j.1600-0609.2011.01712.x
    We investigated the role of lipocalin-2 (LCN-2) and its receptor (SLC22A17) in mediating clonal dominance in a patient with both BCR-ABL and JAK2-V617F mutations. LCN-2 mRNA showed a near 50-fold increase in expression, accompanied by down-regulation of SLC22A17, coinciding with increase in BCR-ABL transcripts, loss of JAK2-V617F and change of clinical phenotype from polycythaemia vera to chronic myeloid leukaemia. These changes were reversed after commencing imatinib mesylate. Consistent with experimental studies, BCR-ABL+ cells express LCN-2 leading to suppression of BCR-ABL- cells and explain their eventual dominance when occurring together with JAK2-V617F.
    Matched MeSH terms: Acute-Phase Proteins/genetics; Proto-Oncogene Proteins/genetics; RNA, Messenger/genetics; Leukemia, Myelogenous, Chronic, BCR-ABL Positive/genetics*; Fusion Proteins, bcr-abl/genetics*; Organic Cation Transport Proteins/genetics; Janus Kinase 2/genetics*; Lipocalins/genetics
  7. Fulltext The molecular landscape of Asian breast cancers reveals clinically relevant population-specific differences
    Pan JW, Zabidi MMA, Ng PS, Meng MY, Hasan SN, Sandey B, et al.
    Nat Commun, 2020 Dec 22;11(1):6433.
    PMID: 33353943 DOI: 10.1038/s41467-020-20173-5
    Molecular profiling of breast cancer has enabled the development of more robust molecular prognostic signatures and therapeutic options for breast cancer patients. However, non-Caucasian populations remain understudied. Here, we present the mutational, transcriptional, and copy number profiles of 560 Malaysian breast tumours and a comparative analysis of breast cancers arising in Asian and Caucasian women. Compared to breast tumours in Caucasian women, we show an increased prevalence of HER2-enriched molecular subtypes and higher prevalence of TP53 somatic mutations in ER+ Asian breast tumours. We also observe elevated immune scores in Asian breast tumours, suggesting potential clinical response to immune checkpoint inhibitors. Whilst HER2-subtype and enriched immune score are associated with improved survival, presence of TP53 somatic mutations is associated with poorer survival in ER+ tumours. Taken together, these population differences unveil opportunities to improve the understanding of this disease and lay the foundation for precision medicine in different populations.
    Matched MeSH terms: Breast Neoplasms/genetics*; Genetics, Population*; Mutation/genetics; Tumor Suppressor Protein p53/genetics; Receptor, ErbB-2/genetics; European Continental Ancestry Group/genetics; Asian Continental Ancestry Group/genetics*
  8. Fulltext Genome-Wide Association Study Data Reveal Genetic Susceptibility to Chronic Inflammatory Intestinal Diseases and Pancreatic Ductal Adenocarcinoma Risk
    Yuan F, Hung RJ, Walsh N, Zhang H, Platz EA, Wheeler W, et al.
    Cancer Res, 2020 Sep 15;80(18):4004-4013.
    PMID: 32641412 DOI: 10.1158/0008-5472.CAN-20-0447
    Registry-based epidemiologic studies suggest associations between chronic inflammatory intestinal diseases and pancreatic ductal adenocarcinoma (PDAC). As genetic susceptibility contributes to a large proportion of chronic inflammatory intestinal diseases, we hypothesize that the genomic regions surrounding established genome-wide associated variants for these chronic inflammatory diseases are associated with PDAC. We examined the association between PDAC and genomic regions (±500 kb) surrounding established common susceptibility variants for ulcerative colitis, Crohn's disease, inflammatory bowel disease, celiac disease, chronic pancreatitis, and primary sclerosing cholangitis. We analyzed summary statistics from genome-wide association studies data for 8,384 cases and 11,955 controls of European descent from two large consortium studies using the summary data-based adaptive rank truncated product method to examine the overall association of combined genomic regions for each inflammatory disease group. Combined genomic susceptibility regions for ulcerative colitis, Crohn disease, inflammatory bowel disease, and chronic pancreatitis were associated with PDAC at P values < 0.05 (0.0040, 0.0057, 0.011, and 3.4 × 10-6, respectively). After excluding the 20 PDAC susceptibility regions (±500 kb) previously identified by GWAS, the genomic regions for ulcerative colitis, Crohn disease, and inflammatory bowel disease remained associated with PDAC (P = 0.0029, 0.0057, and 0.0098, respectively). Genomic regions for celiac disease (P = 0.22) and primary sclerosing cholangitis (P = 0.078) were not associated with PDAC. Our results support the hypothesis that genomic regions surrounding variants associated with inflammatory intestinal diseases, particularly, ulcerative colitis, Crohn disease, inflammatory bowel disease, and chronic pancreatitis are associated with PDAC. SIGNIFICANCE: The joint effects of common variants in genomic regions containing susceptibility loci for inflammatory bowel disease and chronic pancreatitis are associated with PDAC and may provide insights to understanding pancreatic cancer etiology.
    Matched MeSH terms: Celiac Disease/genetics; Colitis, Ulcerative/genetics; Crohn Disease/genetics; Pancreatic Neoplasms/genetics*; Cholangitis, Sclerosing/genetics; Inflammatory Bowel Diseases/genetics*; Carcinoma, Pancreatic Ductal/genetics*; Pancreatitis, Chronic/genetics
  9. Fulltext Phylogeography, colouration, and cryptic speciation across the Indo-Pacific in the sea urchin genus Echinothrix
    Coppard SE, Jessop H, Lessios HA
    Sci Rep, 2021 Aug 16;11(1):16568.
    PMID: 34400682 DOI: 10.1038/s41598-021-95872-0
    The sea urchins Echinothrix calamaris and Echinothrix diadema have sympatric distributions throughout the Indo-Pacific. Diverse colour variation is reported in both species. To reconstruct the phylogeny of the genus and assess gene flow across the Indo-Pacific we sequenced mitochondrial 16S rDNA, ATPase-6, and ATPase-8, and nuclear 28S rDNA and the Calpain-7 intron. Our analyses revealed that E. diadema formed a single trans-Indo-Pacific clade, but E. calamaris contained three discrete clades. One clade was endemic to the Red Sea and the Gulf of Oman. A second clade occurred from Malaysia in the West to Moorea in the East. A third clade of E. calamaris was distributed across the entire Indo-Pacific biogeographic region. A fossil calibrated phylogeny revealed that the ancestor of E. diadema diverged from the ancestor of E. calamaris ~ 16.8 million years ago (Ma), and that the ancestor of the trans-Indo-Pacific clade and Red Sea and Gulf of Oman clade split from the western and central Pacific clade ~ 9.8 Ma. Time since divergence and genetic distances suggested species level differentiation among clades of E. calamaris. Colour variation was extensive in E. calamaris, but not clade or locality specific. There was little colour polymorphism in E. diadema.
    Matched MeSH terms: Adenosine Triphosphatases/genetics; Calpain/genetics; DNA, Mitochondrial/genetics; DNA, Ribosomal/genetics; Introns/genetics; RNA, Ribosomal, 16S/genetics; RNA, Ribosomal, 28S/genetics; Sea Urchins/genetics
  10. Characterization of human adipose-derived stem cells and expression of chondrogenic genes during induction of cartilage differentiation
    Hamid AA, Idrus RB, Saim AB, Sathappan S, Chua KH
    Clinics (Sao Paulo), 2012;67(2):99-106.
    PMID: 22358233
    OBJECTIVES: Understanding the changes in chondrogenic gene expression that are involved in the differentiation of human adipose-derived stem cells to chondrogenic cells is important prior to using this approach for cartilage repair. The aims of the study were to characterize human adipose-derived stem cells and to examine chondrogenic gene expression after one, two, and three weeks of induction.

    MATERIALS AND METHODS: Human adipose-derived stem cells at passage 4 were evaluated by flow cytometry to examine the expression of surface markers. These adipose-derived stem cells were tested for adipogenic and osteogenic differentiation capacity. Ribonucleic acid was extracted from the cells for quantitative polymerase chain reaction analysis to determine the expression levels of chondrogenic genes after chondrogenic induction.

    RESULTS: Human adipose-derived stem cells were strongly positive for the mesenchymal markers CD90, CD73, CD44, CD9, and histocompatibility antigen and successfully differentiated into adipogenic and osteogenic lineages. The human adipose-derived stem cells aggregated and formed a dense matrix after chondrogenic induction. The expression of chondrogenic genes (collagen type II, aggrecan core protein, collagen type XI, COMP, and ELASTIN) was significantly higher after the first week of induction. However, a significantly elevated expression of collagen type X was observed after three weeks of chondrogenic induction.

    CONCLUSION: Human adipose-derived stem cells retain stem cell characteristics after expansion in culture to passage 4 and serve as a feasible source of cells for cartilage regeneration. Chondrogenesis in human adipose-derived stem cells was most prominent after one week of chondrogenic induction.

    Matched MeSH terms: Cell Differentiation/genetics*; Collagen/genetics; Elastin/genetics; Osteogenesis/genetics; RNA, Messenger/genetics; Chondrogenesis/genetics*; Adipogenesis/genetics; SOX9 Transcription Factor/genetics
  11. Fulltext The Influence of OLR1 and PCSK9 Gene Polymorphisms on Ischemic Stroke: Evidence from a Meta-Analysis
    Au A, Griffiths LR, Cheng KK, Wee Kooi C, Irene L, Keat Wei L
    Sci Rep, 2015 Dec 15;5:18224.
    PMID: 26666837 DOI: 10.1038/srep18224
    Both OLR1 and PCSK9 genes are associated with atherosclerosis, cardiovascular disease and ischemic stroke. The overall prevalence of PCSK9 rs505151 and OLR1 rs11053646 variants in ischemic stroke were 0.005 and 0.116, respectively. However, to date, association between these polymorphisms and ischemic stroke remains inconclusive. Therefore, this first meta-analysis was carried out to clarify the presumed influence of these polymorphisms on ischemic stroke. All eligible case-control and cohort studies that met the search terms were retrieved in multiple databases. Demographic and genotyping data were extracted from each study, and the meta-analysis was performed using RevMan 5.3 and Metafor R 3.2.1. The pooled odd ratios (ORs) and 95% confidence intervals (CIs) were calculated using both fixed- and random-effect models. Seven case-control studies encompassing 1897 cases and 2119 controls were critically evaluated. Pooled results from the genetic models indicated that OLR1 rs11053646 dominant (OR = 1.33, 95%  CI:1.11-1.58) and co-dominant models (OR = 1.24, 95%  CI:1.02-1.51) were significantly associated with ischemic stroke. For the PCSK9 rs505151 polymorphism, the OR of co-dominant model (OR = 1.36, 95%  CI:1.01-1.58) was found to be higher among ischemic stroke patients. In conclusion, the current meta-analysis highlighted that variant allele of OLR1 rs11053646 G > C and PCSK9 rs505151 A > G may contribute to the susceptibility risk of ischemic stroke.
    Matched MeSH terms: Serine Endopeptidases/genetics*; Stroke/genetics*; Proprotein Convertases/genetics*; Scavenger Receptors, Class E/genetics*
  12. Transfusion-dependent thalassemia in Northern Sarawak: a molecular study to identify different genotypes in the multi-ethnic groups and the importance of genomic sequencing in unstudied populations
    Tan JA, Chin SS, Ong GB, Mohamed Unni MN, Soosay AE, Gudum HR, et al.
    Public Health Genomics, 2015;18(1):60-4.
    PMID: 25412720 DOI: 10.1159/000368342
    BACKGROUND: Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak.
    METHODS: Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing.
    RESULTS: Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients.
    CONCLUSION: The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations.
    Matched MeSH terms: Ethnic Groups/genetics; Hemoglobinopathies/genetics; Population Groups/genetics; beta-Globins/genetics*
  13. Recurrent parent genome recovery analysis in a marker-assisted backcrossing program of rice (Oryza sativa L.)
    Miah G, Rafii MY, Ismail MR, Puteh AB, Rahim HA, Latif MA
    C. R. Biol., 2015 Feb;338(2):83-94.
    PMID: 25553855 DOI: 10.1016/j.crvi.2014.11.003
    Backcross breeding is the most commonly used method for incorporating a blast resistance gene into a rice cultivar. Linkage between the resistance gene and undesirable units can persist for many generations of backcrossing. Marker-assisted backcrossing (MABC) along with marker-assisted selection (MAS) contributes immensely to overcome the main limitation of the conventional breeding and accelerates recurrent parent genome (RPG) recovery. The MABC approach was employed to incorporate (a) blast resistance gene(s) from the donor parent Pongsu Seribu 1, the blast-resistant local variety in Malaysia, into the genetic background of MR219, a popular high-yielding rice variety that is blast susceptible, to develop a blast-resistant MR219 improved variety. In this perspective, the recurrent parent genome recovery was analyzed in early generations of backcrossing using simple sequence repeat (SSR) markers. Out of 375 SSR markers, 70 markers were found polymorphic between the parents, and these markers were used to evaluate the plants in subsequent generations. Background analysis revealed that the extent of RPG recovery ranged from 75.40% to 91.3% and from 80.40% to 96.70% in BC1F1 and BC2F1 generations, respectively. In this study, the recurrent parent genome content in the selected BC2F2 lines ranged from 92.7% to 97.7%. The average proportion of the recurrent parent in the selected improved line was 95.98%. MAS allowed identification of the plants that are more similar to the recurrent parent for the loci evaluated in backcross generations. The application of MAS with the MABC breeding program accelerated the recovery of the RP genome, reducing the number of generations and the time for incorporating resistance against rice blast.
    Matched MeSH terms: Plant Diseases/genetics; Oryza/genetics*; Chromosomes, Plant/genetics; Disease Resistance/genetics
  14. Fulltext Fine mapping of a grain weight quantitative trait locus, qGW6, using near isogenic lines derived from Oryza rufipogon IRGC105491 and Oryza sativa cultivar MR219
    Ngu MS, Thomson MJ, Bhuiyan MA, Ho C, Wickneswari R
    Genet. Mol. Res., 2014;13(4):9477-88.
    PMID: 25501158 DOI: 10.4238/2014.November.11.13
    Grain weight is a major component of rice grain yield and is controlled by quantitative trait loci. Previously, a rice grain weight quantitative trait locus (qGW6) was detected near marker RM587 on chromosome 6 in a backcross population (BC2F2) derived from a cross between Oryza rufipogon IRGC105491 and O. sativa cv. MR219. Using a BC2F5 population, qGW6 was validated and mapped to a region of 4.8 cM (1.2 Mb) in the interval between RM508 and RM588. Fine mapping using a series of BC4F3 near isogenic lines further narrowed the interval containing qGW6 to 88 kb between markers RM19268 and RM19271.1. According to the Duncan multiple range test, 8 BC4F4 near isogenic lines had significantly higher 100-grain weight (4.8 to 7.5% over MR219) than their recurrent parent, MR219 (P < 0.05). According to the rice genome automated annotation database, there are 20 predicted genes in the 88-kb target region, and 9 of them have known functions. Among the genes with known functions in the target region, in silico gene expression analysis showed that 9 were differentially expressed during the seed development stage(s) from gene expression series GSE6893; however, only 3 of them have known functions. These candidates provide targets for further characterization of qGW6, which will assist in understanding the genetic control of grain weight in rice.
    Matched MeSH terms: Organ Size/genetics; Oryza/genetics*; Seeds/genetics*; Quantitative Trait Loci/genetics*
  15. Role of miRNA in head and neck squamous cell carcinoma
    Masood Y, Kqueen CY, Rajadurai P
    Expert Rev Anticancer Ther, 2015 Feb;15(2):183-97.
    PMID: 25367254 DOI: 10.1586/14737140.2015.978294
    Head and neck squamous cell carcinoma (HNSCC) is the sixth most common malignancy worldwide. Evidence suggests that miRNAs play an important role in progression, recurrence, metastasis and postoperative survival of HNSCC. Studies have investigated the utility of miRNAs as diagnostic/prognostic tools and as potential therapeutic targets and biomarkers that may improve the management and outcomes of HNSCC. The aim of this article is to review the current literature on aberrant expression profiles of miRNAs in biopsy samples of HNSCC and their role in cancer development, metastasis, prognosis and survival of these patients. This review gives an overview that miRNAs deregulation play major role in the development of HNSCC. They offer the potential to be used as biomarkers or novel therapeutic targets. Future research is required to test their use in both of these fields.
    Matched MeSH terms: Carcinoma, Squamous Cell/genetics*; Head and Neck Neoplasms/genetics*; Biomarkers, Tumor/genetics; MicroRNAs/genetics*
  16. Fulltext First molecular data and the phylogenetic position of the millipede-like centipede Edentistoma octosulcatum Tömösváry, 1882 (Chilopoda: Scolopendromorpha: Scolopendridae)
    Vahtera V, Edgecombe GD
    PLoS One, 2014;9(11):e112461.
    PMID: 25389773 DOI: 10.1371/journal.pone.0112461
    Edentistoma octosulcatum Tömösváry, 1882, is a rare, superficially millipede-like centipede known only from Borneo and the Philippines. It is unique within the order Scolopendromorpha for its slow gait, robust tergites, and highly modified gizzard and mandible morphology. Not much is known about the biology of the species but it has been speculated to be arboreal with a possibly vegetarian diet. Until now its phylogenetic position within the subfamily Otostigminae has been based only on morphological characters, being variably ranked as a monotypic tribe (Arrhabdotini) or classified with the Southeast Asian genus Sterropristes Attems, 1934. The first molecular data for E. octosulcatum sourced from a newly collected specimen from Sarawak were analysed with and without morphology. Parsimony analysis of 122 morphological characters together with two nuclear and two mitochondrial loci resolves Edentistoma as sister group to three Indo-Australian species of Rhysida, this clade in turn grouping with Ethmostigmus, whereas maximum likelihood and parsimony analyses of the molecular data on their own ally Edentistoma with species of Otostigmus. A position of Edentistoma within Otostigmini (rather than being its sister group as predicted by the Arrhabdotini hypothesis) is consistently retrieved under different analytical conditions, but support values within the subfamily remain low for most nodes. The species exhibits strong pushing behaviour, suggestive of burrowing habits. Evidence against a suggested vegetarian diet is provided by observation of E. octosulcatum feeding on millipedes in the genus Trachelomegalus.
    Matched MeSH terms: Arthropods/genetics; Cell Nucleus/genetics; DNA, Mitochondrial/genetics*; Mitochondria/genetics
  17. Fulltext Global genome comparative analysis reveals insights of resistome and life-style adaptation of Pseudomonas putida strain T2-2 in oral cavity
    Chan XY, Chua KO, How KY, Yin WF, Chan KG
    ScientificWorldJournal, 2014;2014:930727.
    PMID: 25436236 DOI: 10.1155/2014/930727
    Most Pseudomonas putida strains are environmental microorganisms exhibiting a wide range of metabolic capability but certain strains have been reported as rare opportunistic pathogens and some emerged as multidrug resistant P. putida. This study aimed to assess the drug resistance profile of, via whole genome analysis, P. putida strain T2-2 isolated from oral cavity. At the same time, we also compared the nonenvironmental strain with environmentally isolated P. putida. In silico comparative genome analysis with available reference strains of P. putida shows that T2-2 has lesser gene counts on carbohydrate and aromatic compounds metabolisms, which suggested its little versatility. The detection of its edd gene also suggested T2-2's catabolism of glucose via ED pathway instead of EMP pathway. On the other hand, its drug resistance profile was observed via in silico gene prediction and most of the genes found were in agreement with drug-susceptibility testing in laboratory by automated VITEK 2. In addition, the finding of putative genes of multidrug resistance efflux pump and ATP-binding cassette transporters in this strain suggests a multidrug resistant phenotype. In summary, it is believed that multiple metabolic characteristics and drug resistance in P. putida strain T2-2 helped in its survival in human oral cavity.
    Matched MeSH terms: Adaptation, Physiological/genetics*; Genome, Bacterial/genetics*; Pseudomonas putida/genetics*; Drug Resistance, Multiple, Bacterial/genetics*
  18. Common variant in the glucokinase regulatory gene rs780094 and risk of nonalcoholic fatty liver disease: a meta-analysis
    Zain SM, Mohamed Z, Mohamed R
    J Gastroenterol Hepatol, 2015 Jan;30(1):21-7.
    PMID: 25167786 DOI: 10.1111/jgh.12714
    BACKGROUND AND AIM: Although studies have suggested that rs780094, a common variant in the glucokinase regulatory (GCKR) gene to be associated with type 2 diabetes, obesity, and their related traits, the genetic basis of the association between GCKR rs780094 and nonalcoholic fatty liver disease (NAFLD) is still being examined. This meta-analysis was performed to evaluate the effect strength caused by GCKR rs780094 on NAFLD.
    METHODS: We searched Medline, PubMed, Scopus, and Embase for relevant articles published up to April 2014. Data were extracted, and summary estimates of the association between GCKR rs780094 and NAFLD were examined. Heterogeneity and publication bias were also examined.
    RESULTS: This meta-analysis incorporated a total of 2091 NAFLD cases and 3003 controls from five studies. Overall, the pooled result indicated that the GCKR rs780094 was significantly associated with increased risk of NAFLD (additive: odds ratio (OR) 1.25, 95% confidence interval (CI) 1.14-1.36, P 
    Matched MeSH terms: Genetic Predisposition to Disease/genetics*; Asian Continental Ancestry Group/genetics; Adaptor Proteins, Signal Transducing/genetics*; Non-alcoholic Fatty Liver Disease/genetics*
  19. Fulltext Short chain N-acyl homoserine lactone production in tropical marine Vibrio sinaloensis strain T47
    Tan PW, Tan WS, Yunos NY, Mohamad NI, Adrian TG, Yin WF, et al.
    Sensors (Basel), 2014;14(7):12958-67.
    PMID: 25046018 DOI: 10.3390/s140712958
    Quorum sensing (QS), acts as one of the gene regulatory systems that allow bacteria to regulate their physiological activities by sensing the population density with synchronization of the signaling molecules that they produce. Here, we report a marine isolate, namely strain T47, and its unique AHL profile. Strain T47 was identified using 16S rRNA sequence analysis confirming that it is a member of Vibrio closely clustered to Vibrio sinaloensis. The isolated V. sinaloensis strain T47 was confirmed to produce N-butanoyl-L-homoserine lactone (C4-HSL) by using high resolution liquid chromatography tandem mass spectrometry. V. sinaloensis strain T47 also formed biofilms and its biofilm formation could be affected by anti-QS compound (cathechin) suggesting this is a QS-regulated trait in V. sinaloensis strain T47. To our knowledge, this is the first documentation of AHL and biofilm production in V. sinaloensis strain T47.
    Matched MeSH terms: RNA, Ribosomal, 16S/genetics; Vibrio/genetics; 4-Butyrolactone/genetics; Quorum Sensing/genetics
  20. Fulltext The genome of the Tiger Milk mushroom, Lignosus rhinocerotis, provides insights into the genetic basis of its medicinal properties
    Yap HY, Chooi YH, Firdaus-Raih M, Fung SY, Ng ST, Tan CS, et al.
    BMC Genomics, 2014;15:635.
    PMID: 25073817 DOI: 10.1186/1471-2164-15-635
    The sclerotium of Lignosus rhinocerotis (Cooke) Ryvarden or Tiger milk mushroom (Polyporales, Basidiomycota) is a valuable folk medicine for indigenous peoples in Southeast Asia. Despite the increasing interest in this ethnobotanical mushroom, very little is known about the molecular and genetic basis of its medicinal and nutraceutical properties.
    Matched MeSH terms: Fungal Proteins/genetics; Genes, Fungal/genetics; Polysaccharides/genetics; Polyporales/genetics*
Related Terms
Filters
Contact Us

Please provide feedback to Administrator (afdal@afpm.org.my)

External Links