Displaying publications 1 - 20 of 63 in total

Abstract:
Sort:
  1. Hajar-Azhari S, Daud N, Muhialdin BJ, Joghee N, Kadum H, Meor Hussin AS
    Int J Food Microbiol, 2023 Jun 16;395:110190.
    PMID: 37030193 DOI: 10.1016/j.ijfoodmicro.2023.110190
    This study evaluated the potential of fermented garlic as a marinated lamb sauce ingredient to improve the quality and shelf life of chilled lamb. Garlic was subjected to Lacto-fermentation for 72 h at 37 °C using Lacticaseibacillus casei. The 1H NMR metabolomics profile showed the presence of eight amino acids and five organic acids in fermented garlic, indicating the attribution to the antioxidant and antimicrobial activities. The FRAP and DPPH assays of fermented garlic revealed antioxidant activities of 0.45 ± 0.09 mmol/100 g DW and 93.85 ± 0.02 %, respectively. Meanwhile, fermented garlic inhibited the growth of Escherichia coli (95 %), Staphylococcus aureus (99 %) and Salmonella Typhimurium (98 %). When fermented garlic was added to the marinade sauce, it successfully reduced the microbial load of lamb meat by 0.5 log CFU/g after 3 days of storage. There were no significant differences in color between the control and marinated lamb after 3 days of marinating in a sauce formulated with fermented garlic. Furthermore, marinated lamb significantly improved water-holding capacity, texture, juiciness, and overall acceptance. These findings indicated a potential addition of fermented garlic in marinade lamb sauce recipes to improve the quality and safety of meat products.
    Matched MeSH terms: Red Meat*
  2. Amir SH, Yuswan MH, Aizat WM, Mansor MK, Desa MNM, Yusof YA, et al.
    J Proteomics, 2021 06 15;241:104240.
    PMID: 33894373 DOI: 10.1016/j.jprot.2021.104240
    Mass spectrometry-based proteomics relies on dedicated software for peptide and protein identification. These software include open-source or commercial-based search engines; wherein, they employ different algorithms to establish their scoring and identified proteins. Although previous comparative studies have differentiated the proteomics results from different software, there are still yet studies specifically been conducted to compare and evaluate the search engine in the field of halal analysis. This is important because the halal analysis is often using commercial meat samples that have been subjected to various processing, further complicating its analysis. Thus, this study aimed to assess three open-source search engines (Comet, X! Tandem, and ProteinProspector) and a commercial-based search engine (ProteinPilot™) against 135 raw tandem mass spectrometry data files from 15 types of pork-based food products for halal analysis. Each database search engine contained high false-discovery rate (FDR); however, a post-searching algorithm called PeptideProphet managed to reduce the FDR, except for ProteinProspector and ProteinPilot™. From this study, the combined database search engine (executed by iProphet) reveals a thorough protein list for pork-based food products; wherein the most abundant proteins are myofibrillar proteins. Thus, this proteomics study will aid the identification of potential peptide and protein biomarkers for future precision halal analysis. SIGNIFICANCE: A critical challenge of halal proteomics is the availability of a database to confirm the inferential peptides as well as proteins. Currently, the established database such as UniProtKB is related to animal proteome; however, the halal proteomics is related to the highly processed meat-based food products. This study highlights the use of different database search engines (Comet, X! Tandem, ProteinProspector, and ProteinPilot™) and their respective algorithms to analyse 135 raw tandem mass spectrometry data files from 15 types of pork-based food products. This is the first attempt that has compared different database search engines in the context of halal proteomics to ensure the effectiveness of controlling the FDR. Previous studies were just focused on the advantages of a certain algorithm over another. Moreover, other previous studies also have mainly reported the use of mass spectrometry-based shotgun proteomics for meat authentication (the most similar field to halal analysis), but none of the studies were reported on halal aspects that used samples originated from highly processed food products. Hence, a systematic comparative study is duly needed for a more comprehensive and thorough proteomics analysis for such samples. In this study, our combinatorial approach for halal proteomics results from the different search engines used (Comet, X! Tandem, and ProteinProspector) has successfully generated a comprehensive spectral library for the pork-based meat products. This combined spectral library is freely available at https://data.mendeley.com/datasets/6dmm8659rm/3. Thus far, this is the first and new attempt at establishing a spectral library for halal proteomics. We also believe this study is a pioneer for halal proteomics that aimed at non-conventional and non-model organism proteomics, protein analytics, protein bioinformatics, and potential biomarker discovery.
    Matched MeSH terms: Red Meat*
  3. Hu R, Zhang M, Jiang Q, Law CL
    Meat Sci, 2023 Apr;198:109084.
    PMID: 36599205 DOI: 10.1016/j.meatsci.2022.109084
    The effect of infrared and microwave alternate thawing (IR + MWT) on frozen pork were compared to fresh, air thawing (AT), infrared thawing (IRT), microwave thawing (MWT). The IR + MWT took only about 11.81 min of the thawing time compared to AT 66.5 min, and the Raman spectroscopy and Low-field nuclear magnetic resonance (LF-NMR) results showed that the IR + MWT maintained better protein secondary structure composition and moisture state compared to MWT and IRT. In terms of thawing losses, IR + MWT had the lowest loss 1.92%. In terms of texture, IR + MWT had the least effect on the post-thawing textural properties and increased the springiness of the meat. Scanning electron microscopy results also showed that there was reduced damage to the muscle structure with IR + MWT. Regarding the odor of the meat after thawing, IR + MWT retained the odor better and was closer to the fresh sample. Therefore, IR + MWT can be used to enhance the thawing rate to protect the quality of the thawed pork.
    Matched MeSH terms: Red Meat*
  4. Windarsih A, Bakar NKA, Dachriyanus, Yuliana ND, Riswanto FDO, Rohman A
    Molecules, 2023 Aug 09;28(16).
    PMID: 37630216 DOI: 10.3390/molecules28165964
    Beef sausage (BS) is one of the most favored meat products due to its nutrition and good taste. However, for economic purposes, BS is often adulterated with pork by unethical players. Pork consumption is strictly prohibited for religions including Islam and Judaism. Therefore, advanced detection methods are highly required to warrant the halal authenticity of BS. This research aimed to develop a liquid chromatography-high-resolution mass spectrometry (LC-HRMS) method to determine the halal authenticity of BS using an untargeted metabolomics approach. LC-HRMS was capable of detecting various metabolites in BS and BS containing pork. The presence of pork in BS could be differentiated using principal component analysis (PCA) and partial least squares-discriminant analysis (PLS-DA) with high accuracy. PLS-DA perfectly classified authentic BS and BS containing pork in all concentration levels of pork with R2X = (0.821), R2Y(= 0.984), and Q2 = (0.795). The level of pork in BS was successfully predicted through partial least squares (PLS) and orthogonal PLS (OPLS) chemometrics. Both models gave high R2 (>0.99) actual and predicted values as well as few errors, indicating good accuracy and precision. Identification of discriminating metabolites' potential as biomarker candidates through variable importance for projections (VIP) value revealed metabolites of 2-arachidonyl-sn-glycero-3-phosphoethanolamine, 3-hydroxyoctanoylcarnitine, 8Z,11Z,14Z-eicosatrienoic acid, D-(+)-galactose, oleamide, 3-hydroxyhexadecanoylcarnitine, arachidonic acid, and α-eleostearic acid as good indicators to detect pork. It can be concluded that LC-HRMS metabolomics combined with PCA, PLS-DA, PLS, and OPLS was successfully used to detect pork adulteration in beef sausages. The results imply that LC-HRMS untargeted metabolomics in combination with chemometrics is a promising alternative as an analytical technique to detect pork in sausage products. Further analysis of larger samples is required to warrant the reproducibility.
    Matched MeSH terms: Red Meat*
  5. Nurul, H., Alistair, T.L.J., Lim, H.W., Noryati, I.
    MyJurnal
    Five different brands of Malaysian commercial beef frankfurters were analyzed for quality characteristics. The proximate contents showed significant differences among the samples. The range of moisture content was 63.0-73.9%; the protein content was 10.63-16.43% while the fat content was 1.71-12.22%. The lightness value (L*) of the uncooked frankfurters, which was in the range of 47.02-52.28, was significantly different among the samples. The lightness of the cooked frankfurters, showed a decrease in all the samples compared to the uncooked samples. No significant differences were observed for the folding test; where all samples showed no cracks after they were folded in half. However, significant differences were observed for the texture analysis. The hardness, cohesiveness, chewiness, springiness, gumminess and shear force ranged between 4.59-10.30 kg, 0.26-0.35, 16.15-51.72 kgmm, 12.73-14.79 mm, 1.17-3.49 kg and 1.67-7.08 kg respectively. The results of the study showed that Malaysian commercial beef frankfurters were significantly different in their physicochemical properties.
    Matched MeSH terms: Red Meat
  6. Wan Rosli W, Nurhanan R, Solihah M, Mohsin S
    Sains Malaysiana, 2011;40:1123-1127.
    The nutrient composition, cooking characteristics and sensory properties of beef patties incorporated with various level of cornsilk were studied. The beef patties were formulated with either 2, 4 or 6% of cornsilk. Protein content increased in line with the cornsilk level in both raw and cooked beef patties. Both raw and cooked patties incorporated with 6% cornsilk recorded the highest protein concentration at 17.2 and 23.3%, respectively. Both raw and cooked patties containing 6% cornsilk recorded the lowest concentration of fat at 12.4 and 11.4%, respectively. All cooked patty samples recorded moisture content ranging from 40.42-42.98%. Beef patty formulated with 6% cornsilk recorded the highest cooking yield at 80.13% compared to other treatments. The addition of cornsilk did not change the sensory properties and consumer acceptability of cornsilk-based beef patties. Cornsilk fibre was effective in improving cooking yield, moisture and fat retention and enhancing texture of beef patties.
    Matched MeSH terms: Red Meat
  7. Rohman A, Nawwaruddin HH, Hossain MAM, Laksitorini MD, Lestari D
    Open Vet J, 2024 Sep;14(9):2484-2492.
    PMID: 39553767 DOI: 10.5455/OVJ.2024.v14.i9.37
    BACKGROUND: Consumer awareness of food adulteration is increasing nowadays. Motivated by economic gain, unethical meat producers try to blend halal meat such as beef with non-halal meat like rat meat (RM).

    AIM: This study aims to develop a real-time polymerase chain reaction (RT-PCR) analysis method to analyze the presence of RM in beef meatballs.

    METHODS: This research was carried out in the following stages: primer design, DNA isolation, analysis of DNA isolates, the optimization of primer annealing temperature, primer specificity test, sensitivity, and repeatability. The validated RT-PCR method was then used to analyze the marketed meatball samples.

    RESULTS: The result showed that the designed primer targeting on ND2 gene set rat mt-DNA (forward: ACTCCATATCTCTCACCATATTTCC; reverse: GGGTTAGGGTACTTAGGATTGTTAG), had good specificity at an optimal annealing temperature of 56.3oC over the other eight species. The developed RT-PCR method produces a limit detection value of 195.31 pg, coefficient of determination (R 2) for linearity of 0.983, amplification efficiency (E) of 100%, and CV value for amplification response of 1.8%. The result showed that the developed RT-PCR method did not detect the presence of RM DNA in eight marketed beef meatball samples.

    CONCLUSION: The developed method meets the acceptance criteria for RT-PCR and can be used as a halal authentication method to identify the presence of RM in beef meatballs.

    Matched MeSH terms: Red Meat/analysis
  8. Bongso TA, Jainudeen MR, Dass S
    Theriogenology, 1981 Apr;15(4):415-25.
    PMID: 16725600
    Forty Droughtmaster bulls were evaluated for breeding soundness, using the method of examination and criteria for classifying bulls of the Society for Theriogenelogy. Eighty three percent of the bulls were classified as satisfactory, 14 percent as questionable and 3 percent as unsatisfactory breeders. Scrotal circumference for 2 to 8-year-old bulls were smaller in questionable and unsatisfactory bulls, as compared to satisfactory bulls. For bulls rated as satisfactory breeders, the scrotal circumference of 37 to 43 cms was higher than for other beef breeds. Three related bulls (2 questionable, 1 satisfactory) carried sperm defects classified as 'knobbed' (38 +/- 3%), 'Dag' (40 +/- 4%) and 'pseudo-droplets' (41 +/- 5%), which may adversely affect fertility.
    Matched MeSH terms: Red Meat
  9. Kim TW, Kim CW, Kwon SG, Hwang JH, Park DH, Kang DG, et al.
    Sains Malaysiana, 2016;45:1097-1103.
    In order to examine differences of meat quality traits depending on pH values post-mortem, the pH range was classified
    according to initial pH (pH45min) and ultimate pH (pH24hr) post-mortem. The differences of meat quality traits depending
    on sex were not changed by a number of amount, except for backfat thickness and fat content. The value of pH45min was
    positively correlated with pHdif, whereas pH24hr was negatively associated with lightness (CIE L*) and protein content. At
    pH45min post-slaughter, collagen content, fat content, shear force, water holding capacity and yellowness (CIE b*) showed
    lower values at the higher pH range of pH>6.7 than those of other ranges, but CIE L* and redness (CIE a*) presented
    the lowest value at the intermediate pH range of pH6.3~6.7. Conversely, at pH24hr post-slaughter, fat and moisture
    contents maintained the highest average values at the higher pH range of pH>6.1, but protein content showed higher
    value at the lower pH range of pH<5.7. Higher pH24hr appeared significantly lower shear force, but higher water holding
    capacity. CIE L*, a*, and b* values showed significantly higher values at the lowest region of pH24hr. Since meat quality
    characteristics seemed to be favored by consumers in rather than at the range of pH5.7~6.1, which showed significant
    differences of meat color, appearance, and meat juiciness, it is suggested that production of pork meat to appropriate
    pH value is performed by pig breeders and control measures taken during pre- and post-slaughters.
    Matched MeSH terms: Red Meat
  10. Alirezalu K, Pirouzi S, Yaghoubi M, Karimi-Dehkordi M, Jafarzadeh S, Mousavi Khaneghah A
    Meat Sci, 2021 Jun;176:108475.
    PMID: 33684807 DOI: 10.1016/j.meatsci.2021.108475
    In the current study, the effect on packaged beef fillets (1 × 5 × 8 cm) of using active chitosan film (1%) was investigated. The fillets were stored at 4 °C for 12 days, and the film contained ɛ-polylysine (ɛ-PL) (0.3, 0.6, and 0.9% w/w). Chemical, microbiological, sensory properties, and quality indices of the fillets were investigated. Added to these factors was an assessment of the influence of ɛ-polylysine incorporation on the optical, structural, barrier, and mechanical specifications (elongation at break and tensile strength) of chitosan films. Based on the findings, a significant difference among the corresponding values to thickness, color, water vapor permeability (WVP), and mechanical specifications between the treated films by ɛ-PL and untreated films were noted. In addition, higher values of thickness and tensile strength were correlated with ɛ-PL added active chitosan films while compared with control samples. Additionally, no significant differences regarding the proximate composition (including protein, moisture, and fat) among beef fillet samples were observed. In this regard, due to significantly lower levels of pH, TVB-N, and TBARS ɛ-PL in enriched films, this technique demonstrated some protective effects on beef fillets. Another observation was that lower levels of the total viable count, coliform, mold, yeasts, and higher sensory properties were significantly associated with samples with added ɛ-PL (0.9%). Therefore, adding ɛ-PL into chitosan films could be introduced as an effective technique to extend the shelf life of beef fillets and maintain their quality indices during refrigerated storage.
    Matched MeSH terms: Red Meat/analysis*; Red Meat/microbiology
  11. Yusuf AL, Adeyemi KD, Roselina K, Alimon AR, Goh YM, Samsudin AA, et al.
    Food Res Int, 2018 09;111:699-707.
    PMID: 30007735 DOI: 10.1016/j.foodres.2018.06.015
    The effects of dietary supplementation of different parts of Andrographis paniculata on fatty acids, lipid oxidation, microbiota and quality attributes of Longissimus thoracis et lumborum (LTL) muscle in goats were assessed. Twenty four, entire Boer bucks (4 months old; 20.18 ± 0.19 kg BW) were randomly allotted to either a basal diet without additive (AP0), a basal diet + 1.5% Andrographis paniculata leaves (APL) or a basal diet + 1.5% Andrographis paniculata whole plant (APW). The bucks were fed the diets for 100 d and slaughtered. The LTL muscle was subjected to a 7 d chill storage. The AP0 meat had higher (p meat. The concentrations of total C18:1trans, total CLA, C18:1n-9, C18:2n-6, C18:3n-3 and C20:5n-3 were higher (p meat than the AP0 meat. Diets had no effect (p > .05) on muscle glycogen, pH, drip loss, chemical composition and lactic acid bacteria count. Cooking loss, shear force, and TBARS values were lower (p meat compared with AP0 (26.49%, 1.13 kg, 0.23 mg MDA/kg) meat. Meat redness was higher (p meat were higher (p meat. Total viable counts and populations of Pseudomonas spp, Escherichia coli and Enterobacteriacea were higher (p meat than in APL and APW meat. The APL exhibited higher (p 
    Matched MeSH terms: Red Meat/analysis*; Red Meat/microbiology
  12. Khor, Poy Hua, Lim, Khong Chiu, Radzliyana Radzuwan
    MyJurnal
    Sports tourism is an essential part of world tourism and is trendy in Malaysia. Malaysia recorded about 2 5 83 million tourist arrivals in 201 8 . Efficient delivery of hospitality services to the sports tourists will contribute to the multi billion dollar sports tourism business. In a competitive sports tourism market, offering sporting event requires being de e ply acknowledged with the reasons that attracts tourists’ choice of specific sporting event and the degree of satisfaction that these sports tourists perceived from the service provided. As so, this present study discusses on the sports event’s quality to w ards attendance of tourists at sports event hosted at northern zone of Malaysia. The objectives of this study are answered based on survey research conducted among 351 sports tourists at the sports event organized at northern zone of Malaysia . The study r e veals that the intangible aspect of sports event’s quality highly affects tourists’ attendance at sports event hosted in Northern Zone of Malaysia, compared to the tangible aspect. Growing economy plays an important role in ensuring the quality of sports e vent. Findings reveal dissimilarities on perception of quality towards sports event between the gender groups, with the male tourists displaying higher sensitivity. Further study on sports events hosted in other region of Malaysia could contribute to deve l opment of quality sports events in promoting Malaysia as an international sports tourism destination.
    Matched MeSH terms: Red Meat
  13. Normaznah Y, Saniah K, Fuzina Noor H, Naseem M, Khatijah M
    Trop Biomed, 2004 Dec;21(2):157-9.
    PMID: 16493409
    A survey was carried out to determine the prevalence of Toxoplasma gondii antibodies among cattle farmers and cattle in the Gombak District, Selangor. A total of 79 human and 73 cattle serum samples were tested for Toxoplasma gondii antibodies by the immunofluorescent technique (IFAT). Results of the survey showed that anti-Toxoplasma gondii antibodies were found in 27.8% of the farmers, while in cattle the positive rate was only 3.8%. The prevalence rate obtained in this study did not differ much from the prevalence reported in previous studies. This suggests that the same degree of risk to this infection exists in the community. In view of the relatively low antibody prevalence in cattle, the risk of acquiring this infection from consuming undercooked beef is realtively low. Further survey on larger sample size is needed to validate the observation.
    Matched MeSH terms: Red Meat
  14. Wong, W.C., Pui, C.F., Tunung, R., Cheah, Y.K., Nakaguchi, Y., Nishibuchi, M., et al.
    MyJurnal
    A total of 112 burger patties (35 beef burger patties, 39 chicken burger patties and 38 fish burger patties) which are commercially available at retail level were investigated for the presence and number of Listeria monocytogenes. These samples were analyzed using MPN-PCR method and conventional culturing methods. L. monocytogenes was detected in 33.3% of chicken burger patties, 22.9% of beef patties, and 10.5% of fish patty samples. From all contaminated raw burger patties, the estimated count of L. monocytogenes was ranged from 3 to 75 MPN/g. The results suggest that burger act as a potential source of listeriosis if the contaminated burger patty is consumed without adequate cooking. The risk associated with consumption of these samples was found to be high particularly for processed food at retail level in Malaysia. Therefore, food manufacturers play an important role in monitoring the manufacturing process and conduct a periodical surveillance on microbiological quality assessment on the processing plants. Besides, there is a need to increase awareness of consumers and food handlers to practice proper cooking of the burger patties before the point of consumption, to reduce the risk of listeria infection.
    Matched MeSH terms: Red Meat
  15. Nurrulhidayah, A.F., Che Man, Y.B., Shuhaimi, M., Rohman, A., Khatib, A., Amin, I.
    MyJurnal
    The use of Fourier transform infrared (FTIR) spectroscopy coupled with chemometric techniques to differentiate butter from beef fat (BF) was investigated. The spectral bands associated with butter, BF, and their mixtures were scanned, interpreted, and identified by relating them to those spectroscopically representative to pure butter and BF. For quantitative analysis, partial least square (PLS) regression was used to develop a calibration model at the selected fingerprint regions of 1500-1000 cm-1, with the values of coefficient of determination (R2) and root mean square error of calibration (RMSEC) are 0.999 and 0.89% (v/v), respectively. The PLS calibration model was subsequently used for the prediction of independent samples containing butter in the binary mixtures with BF. Using 6 principal components, root mean square error of prediction (RMSEP) is 2.42% (v/v). These results proved that FTIR spectroscopy in combination with multivariate calibration can be used for the detection and quantification of BF in butter formulation for authentication use.
    Matched MeSH terms: Red Meat
  16. Wan Rosli, W. I., Solihah, M. A.
    MyJurnal
    Mushrooms are well known to be healthy because they are low in calories, fat and cholesterol level but rich in vitamin and other essential nutrients. The grey oyster mushroom, Pleurotus sajor-caju (PSC), is a common edible mushroom and is now grown commercially around the world for food and food products. The ability of PSC in changing physical characteristics and sensory properties of beef patty formulated with this fungus were investigated. Result shows beef patty added with 50% ground PSC recorded the highest concentration total dietary fibre (TDF) at 9.95 g/100g compared to beef patty containing 25% of PSC (7.00 g/100g) and control (3.90g/100g). Beef which was replaced with 25% of PSC, recorded the highest cooking yield (76.62%) and moisture retention (59.80%) respectively. On the other physical traits, beef patty containing 25%
    PSC recorded fat retention at 89.04% and was not significant (P
    Matched MeSH terms: Red Meat
  17. Tey, Y.S., Mad Nasir, S., Alias, R., Zainalabidin, M., Amin, M.A.
    MyJurnal
    Using the Malaysian Household Expenditure Survey 2004/2005 data, this study investigated Malaysian consumers’ preference for beef quantity, quality, and lean beef. Demand and price models that incorporated consumer socio-economic variables were estimated via two-stage least squares (2SLS). This study showed that Malaysian consumers tend to demand for more quantity rather than quality of beef products. Malaysian consumers are also more responsive to price changes rather than fat reduction in beef products. It is more profitable for beef market players to increase their production as Malaysian consumers are expected to consume increasing amounts of beef products.
    Matched MeSH terms: Red Meat
  18. Johari J.A., Jasmi Y.
    MyJurnal
    Population growth and rise in per capital income have influenced the demand for convenience foods and a meat protein-rich diet. The per capital consumption of beef which had increased from 3.89 kg in 1980 to 5.49 kg in 2006 (DVS, 2006/2007) had resulted in an increased in demand for beef at the rate of 6.2% annually. The local beef production although recorded a 2.5% increased over the last 10 years, is still unable to meat the increasing national demand for beef. In 2008, local production of beef is about 38,250 mt. could only meet about 26.7% of the national demand (DVS, 2008). The gap between supply and demand for beef is expected to widen in the next decades unless efforts is been made to accelerate local production. The lack of number of quality breeding stocks and unorganized breeding system had been the major factors that contribute to the slow growth of the local beef industry.
    Matched MeSH terms: Red Meat
  19. Ismail I, Hwang YH, Bakhsh A, Joo ST
    Asian-Australas J Anim Sci, 2019 Feb;32(2):282-289.
    PMID: 30208691 DOI: 10.5713/ajas.18.0347
    OBJECTIVE: This study aimed to elucidate whether innovative sous vide treatment has a significant influence on the beef semitendinosus muscle as compared to common sous vide treatment and traditional cooking.

    METHODS: The innovative sous vide treatments were cooked at 45°C and 65°C for 6 h (SV45-65), common sous vide treatment at 45°C and 65°C for 3 h (SV45 and SV65) and traditional cooking at 75°C for 30 min (CON75). Water loss and cooking loss, as well as the physical properties (color and shear force) and chemical properties (protein and collagen solubility) of the treated meat, were investigated.

    RESULTS: The results obtained indicated that the innovative sous vide with double thermal treatment (SV45-65) and cooked with air presence (CON75) resulted to lower a* and higher b* values, respectively. The water loss and cooking loss increased when temperature increased from 45°C to 65°C, and lower water loss was recorded in SV45 and CON75. These samples presented higher water content and revealed strong correlation to protein solubility. Warner-Bratzler shear force (SF) analysis showed the marked interaction between cooking temperature and time. Sample cooked at a high temperature (CON75) and a long period (SV45-65) showed a significantly lower value of SF than sample SV65 (p<0.05). Interestingly, there was no difference in SF values between SV45-65 and CON75.

    CONCLUSION: The innovative sous vide treatment with double thermal effect appears an attractive cooking method as compared to common sous vide and traditional cooking method, as it has a potential for improving tenderness values of cooked beef semitendinosus muscle.

    Matched MeSH terms: Red Meat
  20. Fakhriyah Nur Ibrahim, Masni Mat Yusoff, Radhiah Shukri, Mohammad Rashedi Ismail-Fitry
    MyJurnal
    Pork and bovine collagen incorporated into meat products showed promising
    functional properties as food ingredients but has the halal issue. This study
    investigated the effect of incorporating fish collagen hydrolysate (FCH) as a fat replacer
    in buffalo patties in terms of proximate values, texture and colour properties. There
    were five different formulations including a control (10% fat, 0% FCH), A (7.5% fat, 2.5%
    FCH), B (5% fat, 5% FCH), C (2.5% fat, 7.5% FCH), and D (0% fat, 10% FCH). There were
    no significant differences (p>0.05) between all formulations in terms of cooking yield,
    shrinkage, water-holding capacity, and pH value. The sensory test showed no
    significant difference (p>0.05) between all formulations in terms of colour,
    appearance, juiciness, aroma, and overall acceptability, while sample D with 10% FCH
    had significantly lower (p
    Matched MeSH terms: Red Meat
Filters
Contact Us

Please provide feedback to Administrator (afdal@afpm.org.my)

External Links