DESIGN AND METHODS: Data were obtained from the medical records and the laboratory information system. Paediatric patients with significant hyperhomocysteinemia were identified from a selective high-risk screening of 96,721 patients, performed between 2010 and 2022. Inclusion criteria for the study were paediatric patients with significant hyperhomocysteinemia (>40 µmol/L).
RESULTS: Sixteen patients were identified. The average total homocysteine (tHcy) and methionine were 269 µmol/L and 499 µmol/L in cystathionine β-synthase deficiency (CBS), 127 µmol/L and 29 µmol/L in patients with remethylation defects and 390 µmol/L and 4 µmol/L in congenital B12 deficiency. We found c.609G>A as the most prevalent mutation in MMACHC gene and possible novel mutations for CBS (c.402del, c.1333C>T and c.1031T>G) and MTHFR genes (c.266T>A and c.1249del). Further subclassification revealed CBS was 5/16 patients (31 %), remethylation defects was 9/16 (56 %) and congenital B12 deficiency was 2/16 (13 %). All patients received standard treatment and regular monitoring of the main biomarkers. The average age at the time of diagnosis were 9.2 years (CBS) and 1.2 years (remethylation defects). Congenital B12 deficiency had slight delay in milestones, remethylation defects had mild to moderate learning disabilities, CBS had variable degree of intellectual disability, delayed milestones, ophthalmological abnormalities, and thrombosis at an early adolescent/adulthood.
CONCLUSIONS: The majority of significant hyperhomocysteinemia in Malaysian children was due to remethylation defects. Screening for hyperhomocysteinemia in Malaysian children is recommended for earlier treatment and improved clinical outcome.
METHODS: Information and opinions regarding the barriers and solutions to the implementation of patient-centred approaches to the management of CU were gathered from a group of 13 expert dermatologists and allergist/immunologists from APAC through surveys and a face-to-face meeting.
RESULTS: Barriers identified there included a lack of awareness of CU amongst patients, delays in consulting healthcare providers, financial constraints, and low adherence. Particular issues raised included a lack of suitable online information for patients (83% of experts), and patients accessing oral corticosteroids without a prescription. Compliance issues were also identified as key reasons for inadequate responses to treatments (67% of experts). Solutions proposed by the authors were improving patients' knowledge about their condition (92% strongly agree, 8% agree), physicians' consideration of patient characteristics when choosing treatments (92% strongly agree, 8% agree), implementing shared decision-making (85% strongly agree, 15% agree), and using patient-reported outcome measures (70% strongly agree, 23% agree).
CONCLUSION: Expert opinion within APAC supports the use of patient-centred approaches to improve the management of CU. We provide several recommendations focusing on patient education and involvement in disease management as well as disease monitoring methods that can be implemented by physicians in APAC.
OBJECTIVE: To assess mothers' KAP toward breastfeeding and complementary feeding.
METHODOLOGY: A cross-sectional study of 200 mothers with 18- to 24-month-old children at six suburban health clinics in Malaysia. Data were collected via a self-explanatory questionnaire and analyzed using descriptive statistics, chi-square, and Spearman's Rho.
RESULTS: Most mothers had good KAP: 72.5 % had good knowledge, 75.5 % had a positive attitude, and 87 % had good practice. Factors such as maternal age (30-39), multiparity, and vaginal delivery were associated with KAP. Significant positive correlations were found between knowledge and attitude (r = 0.591) and attitude and practice (r = 0.525).
CONCLUSIONS: Continued education on breastfeeding and complementary feeding is essential for improving infant feeding practice, and enhancing child development, potentially reducing healthcare costs.
AIM: The objective of this study was to assess the impact of ethyl acetate extract of fungus comb (EAEFC) on the inflammatory reaction in the spleen of mice induced by intraperitoneal injection of lipopolysaccharide (LPS).
METHODS: An experimental study was conducted using a post-test-only control group design with male BALB/C mice (n = 24). The mice were divided randomly into four groups, each comprising six mice, and administered substances via gavage. Groups I and III were administered a solution of 5% dimethyl sulfoxide (DMSO) in distilled water, while Groups II and IV were given 500 mg/kg BW EAEFC dissolved in 5% DMSO. On the fifteenth day, Groups I and II received intraperitoneal injections of 5 ml/kg BW saline, while Groups III and IV were injected with 10 mg/kg BW LPS dissolved in saline. After three hours, the mice were euthanized and splenic immunohistology was examined under a light microscope. The results were expressed as mean ± standard deviation, while the group differences were assessed statistically.
RESULTS: The expression of interleukin (IL)-1, furin, and activated NK cell was significantly higher in the inflamed model after EAEFC supplementation, while the extract suppressed IL-10.
CONCLUSION: EAEFC was found to alter cytokine expression in the spleen in response to inflammation.
AIM: This study aims to develop a real-time polymerase chain reaction (RT-PCR) analysis method to analyze the presence of RM in beef meatballs.
METHODS: This research was carried out in the following stages: primer design, DNA isolation, analysis of DNA isolates, the optimization of primer annealing temperature, primer specificity test, sensitivity, and repeatability. The validated RT-PCR method was then used to analyze the marketed meatball samples.
RESULTS: The result showed that the designed primer targeting on ND2 gene set rat mt-DNA (forward: ACTCCATATCTCTCACCATATTTCC; reverse: GGGTTAGGGTACTTAGGATTGTTAG), had good specificity at an optimal annealing temperature of 56.3oC over the other eight species. The developed RT-PCR method produces a limit detection value of 195.31 pg, coefficient of determination (R 2) for linearity of 0.983, amplification efficiency (E) of 100%, and CV value for amplification response of 1.8%. The result showed that the developed RT-PCR method did not detect the presence of RM DNA in eight marketed beef meatball samples.
CONCLUSION: The developed method meets the acceptance criteria for RT-PCR and can be used as a halal authentication method to identify the presence of RM in beef meatballs.