METHODS: Information and opinions regarding the barriers and solutions to the implementation of patient-centred approaches to the management of CU were gathered from a group of 13 expert dermatologists and allergist/immunologists from APAC through surveys and a face-to-face meeting.
RESULTS: Barriers identified there included a lack of awareness of CU amongst patients, delays in consulting healthcare providers, financial constraints, and low adherence. Particular issues raised included a lack of suitable online information for patients (83% of experts), and patients accessing oral corticosteroids without a prescription. Compliance issues were also identified as key reasons for inadequate responses to treatments (67% of experts). Solutions proposed by the authors were improving patients' knowledge about their condition (92% strongly agree, 8% agree), physicians' consideration of patient characteristics when choosing treatments (92% strongly agree, 8% agree), implementing shared decision-making (85% strongly agree, 15% agree), and using patient-reported outcome measures (70% strongly agree, 23% agree).
CONCLUSION: Expert opinion within APAC supports the use of patient-centred approaches to improve the management of CU. We provide several recommendations focusing on patient education and involvement in disease management as well as disease monitoring methods that can be implemented by physicians in APAC.
OBJECTIVE: To assess mothers' KAP toward breastfeeding and complementary feeding.
METHODOLOGY: A cross-sectional study of 200 mothers with 18- to 24-month-old children at six suburban health clinics in Malaysia. Data were collected via a self-explanatory questionnaire and analyzed using descriptive statistics, chi-square, and Spearman's Rho.
RESULTS: Most mothers had good KAP: 72.5 % had good knowledge, 75.5 % had a positive attitude, and 87 % had good practice. Factors such as maternal age (30-39), multiparity, and vaginal delivery were associated with KAP. Significant positive correlations were found between knowledge and attitude (r = 0.591) and attitude and practice (r = 0.525).
CONCLUSIONS: Continued education on breastfeeding and complementary feeding is essential for improving infant feeding practice, and enhancing child development, potentially reducing healthcare costs.
AIM: The objective of this study was to assess the impact of ethyl acetate extract of fungus comb (EAEFC) on the inflammatory reaction in the spleen of mice induced by intraperitoneal injection of lipopolysaccharide (LPS).
METHODS: An experimental study was conducted using a post-test-only control group design with male BALB/C mice (n = 24). The mice were divided randomly into four groups, each comprising six mice, and administered substances via gavage. Groups I and III were administered a solution of 5% dimethyl sulfoxide (DMSO) in distilled water, while Groups II and IV were given 500 mg/kg BW EAEFC dissolved in 5% DMSO. On the fifteenth day, Groups I and II received intraperitoneal injections of 5 ml/kg BW saline, while Groups III and IV were injected with 10 mg/kg BW LPS dissolved in saline. After three hours, the mice were euthanized and splenic immunohistology was examined under a light microscope. The results were expressed as mean ± standard deviation, while the group differences were assessed statistically.
RESULTS: The expression of interleukin (IL)-1, furin, and activated NK cell was significantly higher in the inflamed model after EAEFC supplementation, while the extract suppressed IL-10.
CONCLUSION: EAEFC was found to alter cytokine expression in the spleen in response to inflammation.
AIM: This study aims to develop a real-time polymerase chain reaction (RT-PCR) analysis method to analyze the presence of RM in beef meatballs.
METHODS: This research was carried out in the following stages: primer design, DNA isolation, analysis of DNA isolates, the optimization of primer annealing temperature, primer specificity test, sensitivity, and repeatability. The validated RT-PCR method was then used to analyze the marketed meatball samples.
RESULTS: The result showed that the designed primer targeting on ND2 gene set rat mt-DNA (forward: ACTCCATATCTCTCACCATATTTCC; reverse: GGGTTAGGGTACTTAGGATTGTTAG), had good specificity at an optimal annealing temperature of 56.3oC over the other eight species. The developed RT-PCR method produces a limit detection value of 195.31 pg, coefficient of determination (R 2) for linearity of 0.983, amplification efficiency (E) of 100%, and CV value for amplification response of 1.8%. The result showed that the developed RT-PCR method did not detect the presence of RM DNA in eight marketed beef meatball samples.
CONCLUSION: The developed method meets the acceptance criteria for RT-PCR and can be used as a halal authentication method to identify the presence of RM in beef meatballs.
AIM: This study evaluates the local and systemic biocompatibility of IVD in five non-pregnant female cats.
METHODS: The IVD was successfully inserted into the vaginal lumen after estrogen administration. Radiographic imaging confirmed the IVD's position, which lasted up to two days post-insertion.
RESULTS: Systemic response, assessed through hematological examinations on days 0, 1, and 3 post-insertion, showed no significant changes in erythrogram and leukogram parameters. Local response, evaluated through vulvar inspection and vaginal cytology on days 0, 1, 3, and 7, revealed no neutrophil infiltration in 4 out of 5 cats, indicating compatibility with vaginal tissue. Furthermore, epithelial cell profile changes were observed, showing an increase in superficial cells, which is typical during the estrus phase.
CONCLUSION: These findings suggest that the IVD is biocompatible and suitable for use as a contraceptive and identity device in cats. However, further long-term studies are necessary to evaluate the device's prolonged efficacy and potential for contraception failure prevention by mating trials.
OBJECTIVE: The aim of this study was to evaluate the clinical effects and accuracy of three-dimensionally (3D)-printed patient-specific surgical plates used for mandibular defect reconstruction.
METHODS: This study included patients who underwent mandibular defect reconstruction with vascularized autogenous bone grafts between January 2012 and August 2021. They were divided into experimental (fixation with 3D-printed surgical plates) and control (fixation with conventional surgical plates) groups. Flap survival rate, postoperative complications and patient self-evaluated facial appearance were compared. Mandibular reconstruction accuracy evaluation included postoperative position deviation of the whole mandible, transplanted bone graft, lower mandibular border, mandibular condyle, and mandibular angle on the reconstructed side compared to baseline.
RESULTS: This study included 20 patients (14 males, six females; age, 39.45 ± 11.69 years), ten each in the experimental and control groups. The mean follow-up was 16 ± 22.05 (range, 6-99) months. All procedures were successful, no plate-related complications (breakage, loosening, or exposure of the surgical plates) were reported, and all patients were satisfied. The groups were statistically similar in th e position deviation of the whole mandible, transplanted bone graft, mandibular condyle, and mandibular angle, but the position and morphology of the lower mandibular border on the reconstructed side in the experimental group were better than those in the control group (P = 0.016).
CONCLUSIONS: 3D-printed patient-specific surgical plates could be applied in mandibular reconstruction safely and effectively, simplifying the surgical procedure, shortening the preoperative preparation times, achieving satisfactory outcomes, and improving the clinical effects and accuracy of individualized mandibular reconstruction.