Introduction: During the last three decades hematopoietic stem cell transplantation (HSCT) has become a well-established treatment for many hematologic malignancies. The most important limitation for HSC transplantation is the low number of hematopoietic stem cells (HSC) that can lead to delayed engraftment or graft failures. Numerous attempts have been made to improve in vitro HSC expansion via optimization of various methods such as isolation techniques, supplementing with growth factors, utilizing stromal cells as feeder layer and other culture conditions. Objective: This project is aimed to decipher the efficiency of an isolation technique and retrieval of culture expanded HSC from feeder layer using two different harvesting methods. Materials and Methods: Hematopoietic stem cells from human umbilical cord blood were isolated via MACS mediated CD34+ double sorting. Then, the cells were cultured onto MSC feeder layer for 3 and 5 days. Culture expanded cells were harvested using two different harvesting method namely cell aspiration and trypsinization methods. Hematopoietic stem cell expansion index were calculated based on harvesting methods for each time point. Results: The numbers of HSC isolated from human umbilical cord blood were 1.64 x 106 and 1.20 x106 cells at single and double sortings respectively. Although the number of sorted cells diminished at the second sorting yet the yield of CD34+ purity has increased from 43.73% at single sorting to 81.40% at double sorting. Employing the trypsinization method, the HSC harvested from feeder layer showed a significant increase in expansion index (EI) as compared to the cell aspiration harvesting method (p≤ 0.05). However, the purity of CD34+ HSC was found higher when the cells were harvested using aspiration method (82.43%) as compared to the trypsinization method (74.13%). Conclusion: A pure population of CD34+ HSC can be retrieved when the cells were double sorted using MACS and expanded in culture after being harvested using cell aspiration method.
Detection and quantification of Hb subtypes of human blood is integral to presumptive identification of thalassaemias. It has been used in neonatal screening of thalassaemia and Hb variants. The use of discarded red blood cells following processing of the cord blood for stem cells provides readily available diagnostic material for thalassaemia screening. In this study, we determined the range of Hb subtypes in 195 consecutive cord blood samples collected for cord blood banking. The 'cord blood samples' analysed were those of the remaining red blood cells after the cord blood was processed for stem cell storage. Quantification of Hb subtypes by high performance liquid chromatography (HPLC) was done on BioRad Variant II Hb testing system. Only 73 (36.5%) of the samples could be analyzed neat without dilution. With a 1:300 dilution with wash solution the acceptable area as recommended by the manufacturer for reading of a C-gram within the 1 to 3 million ranges were achieved in all. Eighteen (9%) 12 showed classical Hb Barts (y4) prerun peaks were confirmed by Sebia Hydrasys automated Hb gel electrophoresis and quantified by Sebia Capillarys 2 capillary electrophoresis. Only 1 (0.5%) was presumptively identified with HbH disease. Due to the limited number of samples no beta-thalassaemia major, Hb E beta-thalassaemia and Hb Barts hydrops fetalis were found. The HPLC assay was possible at a cost US$ 5 per sample and a turnover time of 10 samples per hour without technical difficulties. This study reports an effective and valuable protocol for thalassaemia screening in red blood cells which would otherwise be discarded during cord blood processing. Cord blood with severe and intermediate forms of thalassaemia can be preselected and not stored.
The haemoglobinopathies and thalassemias represent the most common inherited monogenic disorders in the world. Beta-thalassaemia major is an ongoing public health problem in Malaysia. Prior to 2004, the country had no national policy for screening and registry for thalassemia. In the absence of a national audit, the true figure of the extent of thalassemia in the Malaysian population was largely presumptive from micro-mapping studies from various research workers in the country. The estimated carrier rate for beta-thalassemia in Malaysia is 3.5-4%. There were 4768 transfusion dependent thalassemia major patients as of May 2010 (Data from National Thalassemia Registry).
The glycosylated haemoglobin (HbA1c) test is the most widely accepted laboratory test for evaluating long term glycaemic control. Patient’s understanding of HbA1c can lead to better glycaemic control. This study is aimed to determine the awareness and level of understanding of HbA1c among type 2 DM patients and its association with glycaemic control. A cross-sectional descriptive study among Type 2 DM patients undergoing routine follow up in an endocrine clinic of a tertiary centre in Malaysia. Patients were invited to answer a validated questionnaire which assessed their awareness and understanding of HbA1c. Their last HbA1c results were retrieved from the laboratory information system. A total of 92 participants were recruited. Fifty-six (60.9%) were aware of the term HbA1c. Fifty percent were categorised as having good HbA1c understanding, with age, monthly income and level of education being the factors associated with understanding. No significant association was noted between HbA1c understanding and glycaemic control, although more patients with good HbA1c understanding had achieved the target glycaemic control compared to those with poor understanding. The level of HbA1c awareness and understanding was acceptable. Factors associated with understanding were age, income and level of education. Continuing efforts however, must be made to improve patients understanding of their disease and clinical disease biomarkers.
β-Thalassemia is a public health problem where 4.5% of Malaysians are β-thalassemia carriers. The genetic disorder is caused by defects in the β-globin gene complex which lead to reduced or complete absence of β-globin chain synthesis. Five TaqMan genotyping assays were designed and developed to detect the common β-thalassemia mutations in Malaysian Malays. The assays were evaluated with 219 "blinded" DNA samples and the results showed 100% sensitivity and specificity. The in-house designed TaqMan genotyping assays were found to be cost- and time-effective for characterization of β-thalassemia mutations in the Malaysian population.
Homozygosity for the α-thalassaemia Southeast Asian (α-SEA) and Filipino β°-thalassaemia (β-FIL) deletions can cause serious complications leading to foetal death or life-long blood transfusions. A rapid and accurate molecular detection assay is essential in populations where the deletions are common. In this study, gap-polymerase chain reaction (PCR) with high resolution melting (HRM) analysis was developed to detect both the large deletions. Melting curves at 86.9 ± 0.1 °C were generated by normal individuals without the α-SEA deletion, 84.7 ± 0.1 °C by homozygous α-SEA deletion individuals and two melting curves at 84.7 ± 0.1 °C and 86.9 ± 0.1 °C by α-SEA deletion carriers. Normal individuals without the β-FIL deletion produce amplicons with a melting temperature (Tm) at 74.6 ± 0.1 °C, homozygous β-FIL individuals produce amplicons with Tm at 73.6 ± 0.1 °C and heterozygous β-FIL individuals generate two amplicons with Tm at 73.6 ± 0.1 °C and 74.6 ± 0.1 °C. Evaluation using blinded tests on 220 DNA samples showed 100% sensitivity and specificity. The developed assays are sensitive and specific for rapid molecular and prenatal diagnosis for the α-SEA and β-FIL deletions.
In Malaysia, Sabah population constitutes the most number of β-thalassaemia cases ranging from asymptomatic to transfusion dependent. Filipino β°-deletion has been reported as the predominant mutation in Sabah [1]. Despite having the same primary mutation, co-inheritance of genetic variants at HbF quantitative trait loci of HBS1L-MYB intergenic region may cause variability in clinical features by affecting the haemoglobin (Hb) subtypes level, especially HbF. Study suggested that MYB would activate γ-globin repressor gene directly and subsequently initiate the molecular HbF repression mechanisms. Polymorphisms within HBS1L-MYB intergenic region would inhibit binding of transcription factor on MYB and leading to elevation of HbF levels [2]. This can act as an ameliorating factor in the clinical presentation of β-thalassaemia patients [3]. This study aimed to elucidate the association of Hb subtypes levels with three HBS1L-MYB variants among 134 Filipino β°-deletion carriers. PCR-RFLP analysis was done for HBSIL-MYB rs4895441 (A→G) while tetra-primers ARMS PCR analysis was done for HBSIL-MYB rs9399137 (T→C) and rs11759553 (A→T) (Fig.1).
The diverse clinical phenotype of hemoglobin E (HbE)/β-thalassemia has not only confounded clinicians in matters of patient management but has also led scientists to investigate the complex mechanisms involved in maintaining the delicate red cell environment where, even with apparent similarities of α- and β-globin genotypes, the phenotype tells a different story. The BTB and CNC homology 1 (BACH1) protein is known to regulate α- and β-globin gene transcriptions during the terminal differentiation of erythroid cells. With the mutations involved in HbE/β-thalassemia disorder, we studied the role of BACH1 in compensating for the globin chain imbalance, albeit for fine-tuning purposes.
Globally, α-thalassaemia is a highly prevalent disease. In Malaysia, this disorder is a well-known public health problem [1]. The three most common deletional α-thalassaemia found in this region include --SEA deletion, -α3.7 and -α4.2 deletions [2]. The prevalence rate of triplication alpha cases such as αααanti3.7 and αααanti4.2 is unknown in Malaysia although it plays a pivotal role in exacerbating the clinical phenotypes in beta thalassaemia carriers [3]. Therefore, the purpose of this study was to design an assay for the detection of triplications and common deletional alpha thalassaemia using droplet digital PCR (ddPCR). Copy number changes were analysed using Quanta-SoftTM software version 1.6.6 after performing ddPCR. Sensitivity and validation analysis were also performed on the DNA samples. The changes in copy number changes (common deletions, duplications and triplications) in the alpha globin gene has been quantitatively detected using ddPCR. For the samples validation as determined by ddPCR, the mean copy number values for αα/αα are 2.0275±0.0177 (HS-40), 1.8175±0.0389 (HBA2), 2.0450±0.0848 (HB 3.7), 2.0050±0.0000 (HBA1). For -α3.7 /--SEA, the mean copy number values are 2.0225±0.2180 (HS-40), 0.9325±0.1213 (HBA2), 0 (HB 3.7), 0.9984±0.1333 (HBA1). As for –α4.2 /--SEA, the mean copy number values are 1.9350 (HS-40), 0 (HBA2), 0.7945 (HB 3.7), 0.8480 (HBA1). The mean copy number values for --SEA/αα samples are 1.9067±0.1327 (HS-40), 0.8164±0.0364 (HBA2), 0.8920±0.0434 (HB 3.7), 0.9148±0.0338 (HBA1) respectively. This study has found that the use of ddPCR is convenient as it allows direct quantification without the requirement of a calibration curve unlike qPCR [4]. Secondly, this study also showed that ddPCR is accurate and precise in the detection of alpha thalassaemia deletions and triplications based on the gene dosages using absolute quantification. In addition, the non-requirement of post-PCR work has minimised the risk of PCR carryover contamination. Thirdly, ddPCR saves time with less turnaround time and minimise the labour work required as compared to techniques such as MLPA which requires DNA denaturation and hybridisation reaction on day 1 while ligation and PCR reaction on day 2. Fourthly, this study found that the detection of α-thalassaemia using ddPCR is sensitive. DNA samples with low concentration as low as 1 ng were able to be detected for α-thalassaemia using ddPCR. The ability to detect minute amount of DNA concentration is crucial particularly in the diagnosing of the lethal HbH hydrops foetalis during the neonatal stage in α-thalassaemia. In conclusion, this is an alternative method (ddPCR) that can be employed for rapid detection of alpha thalassaemia variants in Malaysia.
The alpha haemoglobin stabilising protein (AHSP) acts as a molecular chaperone for α-globin by stabilising nascent α-globin before transferring it to waiting free β-globin chains. Binding of AHSP to α-globin renders α-globin chemically inert whereby preventing it from precipitating and forming reactive oxygen species byproducts. The AHSP has been actively studied in the recent years, particularly in its relation to β-thalassaemia. Studies have shown that AHSP is a modifier in β-thalassaemia mice models. However, this relationship is less established in humans. Studies by some groups showed no correlation between the AHSP haplotypes and the severity of β-thalassaemia, whereas others have shown that certain AHSP haplotype could modify the phenotype of β-thalassaemia intermedia patients. We investigated the expression of AHSP in relation to selected demographic data, full blood count, HPLC results, HbE/β-thalassaemia genotype, Xmn-1 Gγ polymorphism, α-globin, β-globin and γ-globin expression. We found that AHSP expression was significantly correlated to mean cell haemoglobin level, HbF %, α-globin, β-globin and excess α-globin expression. We concluded that AHSP could be a secondary compensatory mechanism in red blood cells to counterbalance the excess α-globin chains in HbE/β-thalassaemia individuals.
HbE/β-thalassaemia is a compound heterozygous mutation with a vast clinical phenotype [1]. To improve quality of life, HbE/β-thalassaemia individuals receive different treatment strategies, either individually or in combination with therapy(ies), including blood transfusion, iron chelation and splenectomy [2-3]. Thus far, there are limited studies conducted regarding the effect of treatments in HbE/β-thalassaemia individuals. We hereby investigated the effect of treatments with respect to red blood cell indices, haemoglobin subtypes and gene expressions among 30 HbE/beta-thalassaemia individuals. Statistical analyses were carried out using SPSS 17.0. As compared to single therapy (transfused only individuals) and double therapies (transfused-chelated only individuals), individuals receiving triple therapies (transfused-chelated-splenectomised individuals) showed significantly high mean cell volume (MCV), mean cell haemoglobin (MCH) and reticulocytes count (Fig.1).
These findings suggest that triple therapies are the most effective in ameliorating the severity of the disease in terms of microcytosis and hypochromia [3-5]. The high reticulocyte count in triple therapies also allows the bone marrow to actively produce red blood cells suggesting that these therapies have clinical benefits by suppressing the ineffective erythropoiesis and improving the erythropoietic environment significantly among HbE/β-thalassaemia individuals in our studied group [6-7].
The effectiveness of these treatments is different among each HbE/β-thalassaemia individual whereby clinical variabilities among them could be a contributing factor. Triple therapies giving the best advantage to the HbE/β-thalassaemia patient in this study.
We have previously shown that human MSC (mesenchymal stem cells) inhibit the proliferation of most of the immune cells. However, there are innate immune cells such as neutrophils and other PMN (polymorphonuclear) cells that do not require an extensive proliferation prior to their effector function. In this study, the effect of MSC on neutrophils in the presence of complete and serum-deprived culture media was investigated. In the presence of MSC, the viability of neutrophils increase as measured in 24 h of incubation at various supplementation of serum concentration. We have utilized Annexin V and PI (propidium iodide) staining to confirm whether the enhancement of neutrophil's viability is due to a reduction in PCD (programmed cell death). MSC significantly rescue neutrophils from apoptosis at 1, 5 and 10% of FBS (fetal bovine serum) supplementation. The fractions of viable and dead cells were increased and decreased respectively in the presence of MSC. Our results indicate MSC rescue neutrophils from nutrient- or serum-deprived cell death. However, whether this effect is exerted through a specific signalling pathway or confining neutrophils in resting state by MSC requires further investigation.
A 2-year-old Malay boy was brought to the University Malaya Medical Centre for thalassaemia screening. Physical examination revealed thalassaemia facies, pallor, mild jaundice, hepatomegaly and splenomegaly. Laboratory investigations on the patient including studies on the parents lead to a presumptive diagnosis of homozygous Haemoglobin Lepore (Hb Lepore). The aim of this paper is to increase awareness of this rare disorder, this being the first case documented in Malaysia in a Malay. The case also demonstrates the need for this disorder to be included in the differential diagnosis of patients presenting clinically like thalassemia intermedia or thalassemia major. Accurate diagnosis would provide information necessary for prenatal diagnosis, proper clinical management and genetic counseling. The clinical, haematological and laboratory features of this disorder are discussed in this paper.
Pre-donation screening declarations and hemoglobin (Hb) testing are measures used to determine the quality of donated blood. The copper sulphate (CuSo4) method used to screen for blood abnormalities can give inaccurate results if strict quality control is not applied. Blood donors who are carriers of thalassemia and those with mild iron deficiency anemia (IDA) are usually asymptomatic and frequently missed at blood donation. The aim of this study was to evaluate the red blood cell (RBC) indices related disorders among blood donors who were deemed qualified to donate blood after screening with CuSo4 method. One hundred fifty-eight volunteer blood donors at the Universiti Putra Malaysia (UPM), who had passed the CuSo4 screening method, were recruited for this study. Their bloods specimens were examined with a complete blood count. Subjects with a low mean corpuscular hemoglobin (MCH) level were examined further by checking a serum ferritin level, Hb quantification, and molecular analysis to examine for common RBC disorders. Fourteen point six percent of subjects had a low Hb level, two (1.3%) had IDA and four (2.5%) had thalassemia or some other hemoglobinopathy. Using a MCH level < 27 pg as a cut-off point, 58 subjects (36.7%) had suspected IDA, thalassemia or some other hemoglobinopathy. Eight point nine percent of subjects with a normal Hb level had thalassemia, and 3.8% had IDA. Malaysia has a high prevalence of thalassemia and other hemoglobinopathies. Pre-donation accurate screening is crucial to protect the quality of blood transfusion products. Public education regarding RBC disorders especially among blood donors is important.
Complete blood count (CBC) is used broadly to screen individual's general health status. Some inherited red blood cell (RBC) disorders influence the RBC parameters. Mean corpuscular volume (MCV) and mean corpuscular haemoglobin (MCH) are amongst the important RBC parameters used in thalassaemia-haemoglobinopathy screening [1-2]. Globin chain disorders and Southeast Asian Ovalocytosis (SAO) are common RBC disorders in Southeast Asian countries [3]. We evaluated the RBC parameters in patients with Hb E and those with SAO co-inheritance.
A total of 33 from 1500 Malay patient’s samples that were sent for thalassaemia-haemoglobinopathies screening in Hospital Kuala Lumpur (HKL) were identified and consented (30 cases with Hb E and 3 cases with co-inheritance of Hb E and SAO). The inclusion criteria were Malay patients with MCV and MCH levels less than 78 fL and 27 pg respectively with presence of oval and stomatocytic RBCs in the peripheral blood film. DNA extraction was performed in samples suspected of having co-inheritance of SAO and Hb E. Primers 198 and 199 (AIT biotech Pte Ltd. Singapore) were designed for SAO detection [4], [5]. Hb E mutation was detected using ARMS PCR [6].
SAO was characterised by presence of an in frame 27bp deletion in exon 11 of the band 3 gene. A band of 175bp was observed in normal subjects and two bands, 175bp and 148bp were observed in heterozygous SAO subjects (Fig. 1).
Background: Diabetic retinopathy (DR) is a microvascular complication of diabetes, which is a cause of visual impairment and blindness. Its development and progression have been linked to dyslipidaemia, although the link remains inconclusive.
Aim: This study aimed to determine the prevalence of dyslipidaemia among type 2 diabetic patients with DR in a tertiary setting and to determine the association between dyslipidaemia and DR severity.
Materials and methods: This was a cross sectional study using retrospective data of type 2 diabetic patients attending the opthalmology clinic of a tertiary centre from January 2007 to June 2014. Results of their fasting lipid profile and clinical data were retrieved from the hospital information system.
Results: A total of 178 patient’s data were collected. 120 (n=67.4%) patients had non-proliferative diabetic retinopathy (NDPR) with moderate NPDR being the most prevalent. Dyslipidaemia was noted in 151 (84.8%) of the patients. Patients had a combination of more than one abnormality in the lipid profile with increased LDL-cholesterol being the main abnormality. Dyslipidaemia was however, not significantly associated with DR severity.
Conclusion: Dyslipidaemia was highly prevalent in DR patients. The dyslipidaemia was however not associated with severity of DR.
Study site: Ophthalmology clinic, Hospital (?name), Malaysia
Thalassemia is known as a diverse single gene disorder, which is prevalent worldwide. The molecular chaperones are set of proteins that help in two important processes while protein synthesis and degradation include folding or unfolding and assembly or disassembly, thereby helping in cell homeostasis. This review recaps current knowledge regarding the role of molecular chaperones in thalassemia, with a focus on beta thalassemia.
BACKGROUND: Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak.
METHODS: Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing.
RESULTS: Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients.
CONCLUSION: The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations.
Haemoglobin (Hb) Adana (HBA2:c.179>A) interacts with deletional and nondeletional α-thalassaemia mutations to produce HbH disorders with varying clinical manifestations from asymptomatic to severe anaemia with significant hepatosplenomegaly. Hb Adana carriers are generally asymptomatic and haemoglobin subtyping is unable to detect this highly unstable α-haemoglobin variant. This study identified 13 patients with compound heterozygosity for Hb Adana with either the 3.7 kb gene deletion (-α(3.7)), Hb Constant Spring (HbCS) (HBA2:c.427T>C) or Hb Paksé (HBA2:429A>T). Multiplex Amplification Refractory Mutation System was used for the detection of five deletional and six nondeletional α-thalassaemia mutations. Duplex-PCR was used to confirm Hb Paksé and HbCS. Results showed 84.6% of the Hb Adana patients were Malays. Using DNA studies, compound heterozygosity for Hb Adana and HbCS (α(codon 59)α/α(CS)α) was confirmed in 11 patients. A novel point in this investigation was that DNA studies confirmed Hb Paksé for the first time in a Malaysian patient (α(codon 59)α/α(Paksé)α) after nine years of being misdiagnosis with Hb Adana and HbCS (α(codon 59)α/α(CS)α). Thus, the reliance on haematology studies and Hb subtyping to detect Hb variants is inadequate in countries where thalassaemia is prevalent and caused by a wide spectrum of mutations.