Displaying publications 1 - 20 of 34 in total

Abstract:
Sort:
  1. α-Haemoglobin stabilising protein expression is influenced by mean cell haemoglobin and HbF levels in HbE/β-thalassaemia individuals
    Lim WF, Muniandi L, George E, Sathar J, Teh LK, Gan GG, et al.
    Blood Cells Mol. Dis., 2012 Jan 15;48(1):17-21.
    PMID: 22079025 DOI: 10.1016/j.bcmd.2011.10.002
    The alpha haemoglobin stabilising protein (AHSP) acts as a molecular chaperone for α-globin by stabilising nascent α-globin before transferring it to waiting free β-globin chains. Binding of AHSP to α-globin renders α-globin chemically inert whereby preventing it from precipitating and forming reactive oxygen species byproducts. The AHSP has been actively studied in the recent years, particularly in its relation to β-thalassaemia. Studies have shown that AHSP is a modifier in β-thalassaemia mice models. However, this relationship is less established in humans. Studies by some groups showed no correlation between the AHSP haplotypes and the severity of β-thalassaemia, whereas others have shown that certain AHSP haplotype could modify the phenotype of β-thalassaemia intermedia patients. We investigated the expression of AHSP in relation to selected demographic data, full blood count, HPLC results, HbE/β-thalassaemia genotype, Xmn-1 Gγ polymorphism, α-globin, β-globin and γ-globin expression. We found that AHSP expression was significantly correlated to mean cell haemoglobin level, HbF %, α-globin, β-globin and excess α-globin expression. We concluded that AHSP could be a secondary compensatory mechanism in red blood cells to counterbalance the excess α-globin chains in HbE/β-thalassaemia individuals.
  2. Transfusion-dependent thalassemia in Northern Sarawak: a molecular study to identify different genotypes in the multi-ethnic groups and the importance of genomic sequencing in unstudied populations
    Tan JA, Chin SS, Ong GB, Mohamed Unni MN, Soosay AE, Gudum HR, et al.
    Public Health Genomics, 2015;18(1):60-4.
    PMID: 25412720 DOI: 10.1159/000368342
    BACKGROUND: Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak.
    METHODS: Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing.
    RESULTS: Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients.
    CONCLUSION: The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations.
  3. Fulltext The efficiency of cell sorting and harvesting methods for In vitro expansion of human umbilical cord blood derived CD34+ hematopoietic stem cells
    Borojerdi, Mohadese Hashem, Maqbool, Maryam, Zuraidah Yusoff, Vidyadaran, Sharmili, Hwa, Ling King, George, Elizabeth, et al.
    Malaysian Journal of Medicine and Health Sciences, 2015;11(2):21-28.
    MyJurnal
    Introduction: During the last three decades hematopoietic stem cell transplantation (HSCT) has become a well-established treatment for many hematologic malignancies. The most important limitation for HSC transplantation is the low number of hematopoietic stem cells (HSC) that can lead to delayed engraftment or graft failures. Numerous attempts have been made to improve in vitro HSC expansion via optimization of various methods such as isolation techniques, supplementing with growth factors, utilizing stromal cells as feeder layer and other culture conditions. Objective: This project is aimed to decipher the efficiency of an isolation technique and retrieval of culture expanded HSC from feeder layer using two different harvesting methods. Materials and Methods: Hematopoietic stem cells from human umbilical cord blood were isolated via MACS mediated CD34+ double sorting. Then, the cells were cultured onto MSC feeder layer for 3 and 5 days. Culture expanded cells were harvested using two different harvesting method namely cell aspiration and trypsinization methods. Hematopoietic stem cell expansion index were calculated based on harvesting methods for each time point. Results: The numbers of HSC isolated from human umbilical cord blood were 1.64 x 106 and 1.20 x106 cells at single and double sortings respectively. Although the number of sorted cells diminished at the second sorting yet the yield of CD34+ purity has increased from 43.73% at single sorting to 81.40% at double sorting. Employing the trypsinization method, the HSC harvested from feeder layer showed a significant increase in expansion index (EI) as compared to the cell aspiration harvesting method (p≤ 0.05). However, the purity of CD34+ HSC was found higher when the cells were harvested using aspiration method (82.43%) as compared to the trypsinization method (74.13%). Conclusion: A pure population of CD34+ HSC can be retrieved when the cells were double sorted using MACS and expanded in culture after being harvested using cell aspiration method.
  4. Thalassemia intermedia in HbH-CS disease with compound heterozygosity for beta-thalassemia: challenges in hemoglobin analysis and clinical diagnosis
    Tan JA, Kok JL, Tan KL, Wee YC, George E
    Genes Genet Syst, 2009 Feb;84(1):67-71.
    PMID: 19420802
    Co-inheritance of alpha-thalassemia with homozygosity or compound heterozygosity for beta-thalassemia may ameliorate beta-thalassemia major. A wide range of clinical phenotypes is produced depending on the number of alpha-thalassemia alleles (-alpha/alphaalpha --/alphaalpha, --/-alpha). The co-inheritance of beta-thalassemia with alpha-thalassemia with a single gene deletion (-alpha/alphaalpha) is usually associated with thalassemia major. In contrast, the co-inheritance of beta-thalassemia with two alpha-genes deleted in cis or trans (--/alphaalpha or -alpha/-alpha) generally produces beta-thalassemia intermedia. In Southeast Asia, the most common defect responsible for alpha-thalassemia is the Southeast Asian (SEA) deletion of 20.5 kilobases. The presence of the SEA deletion with Hb Constant Spring (HbCS) produces HbH-CS disease. Co-inheritance of HbH-CS with compound heterozygosity for beta-thalassemia is very rare. This study presents a Malay patient with HbH-CS disorder and beta degrees/beta+-thalassemia. The SEA deletion was confirmed in the patient using a duplex-PCR. A Combine-Amplification Refractory Mutation System (C-ARMS) technique to simultaneously detect HbCS and Hb Quong Sze confirmed HbCS in the patient. Compound heterozygosity for CD41/42 and Poly A was confirmed using the ARMS. This is a unique case as the SEA alpha-gene deletion in cis (--SEA/alphaalpha) is generally not present in the Malays, who more commonly possess the two alpha-gene deletion in trans (-alpha/-alpha). In addition, the beta-globin gene mutation at CD41/42 is a common mutation in the Chinese and not in the Malays. The presence of both the SEA deletion and CD41/42 in the mother of the patient suggests the possible introduction of these two defects into the family by marriage with a Chinese.
  5. Fulltext Screening for intermediate and severe forms of thalassaemia in discarded red blood cells: optimization and feasibility
    George E, Lai MI, Teh LK, Ramasamy R, Goh EH, Asokan K, et al.
    Med J Malaysia, 2011 Dec;66(5):429-34.
    PMID: 22390095 MyJurnal
    Detection and quantification of Hb subtypes of human blood is integral to presumptive identification of thalassaemias. It has been used in neonatal screening of thalassaemia and Hb variants. The use of discarded red blood cells following processing of the cord blood for stem cells provides readily available diagnostic material for thalassaemia screening. In this study, we determined the range of Hb subtypes in 195 consecutive cord blood samples collected for cord blood banking. The 'cord blood samples' analysed were those of the remaining red blood cells after the cord blood was processed for stem cell storage. Quantification of Hb subtypes by high performance liquid chromatography (HPLC) was done on BioRad Variant II Hb testing system. Only 73 (36.5%) of the samples could be analyzed neat without dilution. With a 1:300 dilution with wash solution the acceptable area as recommended by the manufacturer for reading of a C-gram within the 1 to 3 million ranges were achieved in all. Eighteen (9%) 12 showed classical Hb Barts (y4) prerun peaks were confirmed by Sebia Hydrasys automated Hb gel electrophoresis and quantified by Sebia Capillarys 2 capillary electrophoresis. Only 1 (0.5%) was presumptively identified with HbH disease. Due to the limited number of samples no beta-thalassaemia major, Hb E beta-thalassaemia and Hb Barts hydrops fetalis were found. The HPLC assay was possible at a cost US$ 5 per sample and a turnover time of 10 samples per hour without technical difficulties. This study reports an effective and valuable protocol for thalassaemia screening in red blood cells which would otherwise be discarded during cord blood processing. Cord blood with severe and intermediate forms of thalassaemia can be preselected and not stored.
  6. Review: Beta-thalassemia and molecular chaperones
    Sumera A, Radhakrishnan A, Baba AA, George E
    Blood Cells Mol. Dis., 2015 Apr;54(4):348-52.
    PMID: 25648458 DOI: 10.1016/j.bcmd.2015.01.008
    Thalassemia is known as a diverse single gene disorder, which is prevalent worldwide. The molecular chaperones are set of proteins that help in two important processes while protein synthesis and degradation include folding or unfolding and assembly or disassembly, thereby helping in cell homeostasis. This review recaps current knowledge regarding the role of molecular chaperones in thalassemia, with a focus on beta thalassemia.
  7. Fulltext Public perceptions and attitudes toward thalassaemia: Influencing factors in a multi-racial population
    Wong LP, George E, Tan JA
    BMC Public Health, 2011;11:193.
    PMID: 21447191 DOI: 10.1186/1471-2458-11-193
    Thalassaemia is a common public health problem in Malaysia and about 4.5 to 6% of the Malays and Chinese are carriers of this genetic disorder. The major forms of thalassaemia result in death in utero of affected foetuses (α-thalassaemia) or life-long blood transfusions for survival in β-thalassaemia. This study, the first nationwide population based survey of thalassaemia in Malaysia, aimed to determine differences in public awareness, perceptions and attitudes toward thalassaemia in the multi-racial population in Malaysia.
  8. Fulltext Prevalence of dyslipidaemia in type 2 diabetes mellitus patients and Its association to diabetic retinopathy in a Malaysian tertiary hospital
    Samsudin IN, Md Saleh R, Thambiah SC, Mohamad Amir Hamzah AS, Wan Khalik WNF, George E
    Malaysian Journal of Medicine and Health Sciences, 2014;10(2):47-51.
    MyJurnal
    Background: Diabetic retinopathy (DR) is a microvascular complication of diabetes, which is a cause of visual impairment and blindness. Its development and progression have been linked to dyslipidaemia, although the link remains inconclusive.
    Aim: This study aimed to determine the prevalence of dyslipidaemia among type 2 diabetic patients with DR in a tertiary setting and to determine the association between dyslipidaemia and DR severity.
    Materials and methods: This was a cross sectional study using retrospective data of type 2 diabetic patients attending the opthalmology clinic of a tertiary centre from January 2007 to June 2014. Results of their fasting lipid profile and clinical data were retrieved from the hospital information system.
    Results: A total of 178 patient’s data were collected. 120 (n=67.4%) patients had non-proliferative diabetic retinopathy (NDPR) with moderate NPDR being the most prevalent. Dyslipidaemia was noted in 151 (84.8%) of the patients. Patients had a combination of more than one abnormality in the lipid profile with increased LDL-cholesterol being the main abnormality. Dyslipidaemia was however, not significantly associated with DR severity.
    Conclusion: Dyslipidaemia was highly prevalent in DR patients. The dyslipidaemia was however not associated with severity of DR.
    Study site: Ophthalmology clinic, Hospital (?name), Malaysia
  9. Fulltext Pre-transplantation serum ferritin as a prognostic marker in allogeneic haemopoietic stem cell transplant patients in a tertiary care hospital in Malaysia
    Thambiah SC, George E, Samsudin IN, Hong LH, Chuo LL, Ramli N, et al.
    Natl Med J India, 2016 May-Jun;29(3):136-140.
    PMID: 27808061
    BACKGROUND: The principal cause of iron overload in patients with haematological malignancies is recurrent red cell transfusions for anaemia. The serum ferritin level reflects the iron burden in the body, in the absence of inflammation or liver disease. In Malaysia, data are lacking on the association between pre-transplant serum ferritin levels and outcome after allogeneic haemopoietic stem cell transplant.

    METHODS: We did a cross-sectional study using retrospective data of 106 post-allogeneic haemopoietic stem cell transplant patients (HLA-matched sibling) with haematological malignancies at Hospital Ampang to determine the relationship between pre-transplant serum ferritin levels and post-transplant outcome, post-transplant complications and survival time. Patients were divided into two groups according to the iron status: serum ferritin level >1000 μg/L (iron overload) and <1000 μg/L.

    RESULTS: The median age for patients was 30.5 (18-58) years. The median pre-transplantation serum ferritin level and the prevalence of pre-transplantation iron overload were 2423 (408.2-7664) μg/L and 87.5%, respectively. No significant association was found between iron status and demographic factors, type of haematological malignancy and post-transplant complications. Although insignificant, patients with iron overload had a shorter survival time (36 months) compared to those with no iron overload (40 months). There was also no significant association between the iron status and post-transplant outcome. Significant post-transplant complications associated with post-transplant outcome were the need for total parenteral nutrition (TPN) (p=0.014) and chronic graft-versus-host disease (GVHD) (p=0.008). Similarly, significant associations were found between age group (p=0.003), TPN (p=0.035) and chronic GVHD (p=0.012) with survival time using Kaplan-Meir analysis. However, after Cox regression, only age group was found to be significantly associated with survival time (p=0.014).

    CONCLUSION: Serum ferritin is an acute phase reactant and its levels increase in the presence of tissue necrosis and inflammation. Both these events occur in haematological malignancies. Although serum ferritin level is a non-invasive, relatively cost-effective, widely available and practical indicator of iron status, it is not specific to iron overload. Therefore, a true association between the serum ferritin level and iron burden is problematic in patients with haematological malignancies.
  10. Fulltext Molecular characterisation of Haemoglobin Constant Spring and Haemoglobin Quong Sze with a Combine-Amplification Refractory Mutation System
    Wee YC, Tan KL, Chua KH, George E, Tan JA
    Malays J Med Sci, 2009 Jul;16(3):21-8.
    PMID: 22589661 MyJurnal
    BACKGROUND: The interaction of the non-deletional α(+)-thalassaemia mutations Haemoglobin Constant Spring and Haemoglobin Quong Sze with the Southeast Asian double α-globin gene deletion results in non-deletional Haemoglobin H disease. Accurate detection of non-deletional Haemoglobin H disease, which is associated with severe phenotypes, is necessary as these mutations have been confirmed in the Malaysian population.
    METHODS: DNA from two families with Haemoglobin H disease was extracted from EDTA-anticoagulated whole blood and subjected to molecular analysis for α-thalassaemia. A duplex polymerase chain reaction was used to detect the Southeast Asian α-globin gene deletion. Polymerase chain reaction-restriction fragment length polymorphism analysis was then carried out to determine the presence of Haemoglobin Constant Spring and Haemoglobin Quong Sze. A combine-amplification refractory mutation system protocol was optimised and implemented for the rapid and specific molecular characterisation of Haemoglobin Constant Spring and Haemoglobin Quong Sze in a single polymerase chain reaction.
    RESULTS AND CONCLUSIONS: The combine-amplification refractory mutation system for Haemoglobin Constant Spring and Haemoglobin Quong Sze, together with the duplex polymerase chain reaction, provides accurate pre- and postnatal diagnosis of non-deletional Haemoglobin H disease and allows detailed genotype analyses using minimal quantities of DNA.
    KEYWORDS: Combine-ARMS; Hb Constant Spring; Hb Quong Sze; medical sciences
  11. Fulltext Molecular characterisation and frequency of Ggamma Xmn I polymorphism in Chinese and Malay beta-thalassaemia patients in Malaysia
    Wong YC, George E, Tan KL, Yap SF, Chan LL, Tan JA
    Malays J Pathol, 2006 Jun;28(1):17-21.
    PMID: 17694955
    The molecular basis of variable phenotypes in P-thalassaemia patients with identical genotypes has been associated with co-inheritance of alpha-thalassaemia and persistence of HbF production in adult life. The Xmn I restriction site at -158 position of the Ggamma-gene is associated with increased expression of the Ggamma-globin gene and higher production of HbF This study aims to determine the frequency of the digammaferent genotypes of the Ggamma Xmn I polymorphism in P-thalassaemia patients in two ethnic groups in Malaysia. Molecular characterisation and frequency of the Ggamma Xmn I polymorphism were studied in fifty-eight Chinese and forty-nine beta-thalassaemia Malay patients by Xmn I digestion after DNA amplification of a 650 bp sequence. The in-house developed technique did not require further purification or concentration of amplified DNA before restriction enzyme digestion. The cheaper Seakem LE agarose was used instead of Nusieve agarose and distinct well separated bands were observed. Genotyping showed that the most frequent genotype observed in the Malaysian Chinese was homozygosity for the absence of the Xmn I site (-/-) (89.7%). In the Malays, heterozygosity of the Xmn I site (+/-) was most common (63.3%). Homozygosity for the Xmn I site (+/+) was absent in the Chinese, but was confirmed in 8.2% of the Malays. The ratio of the (+) allele (presence of the Xmn I site) to the (-) allele (absence of the Xmn I site)) was higher in the Malays (0.66) compared to the Chinese (0.05). The (+/-) and (+/+) genotypes are more commonly observed in the Malays than the Chinese in Malaysia.
  12. Molecular basis of transfusion dependent beta-thalassemia major patients in Sabah
    Teh LK, George E, Lai MI, Tan JA, Wong L, Ismail P
    J Hum Genet, 2014 Mar;59(3):119-23.
    PMID: 24369358 DOI: 10.1038/jhg.2013.131
    Beta-thalassemia is one of the most prevalent inherited diseases and a public health problem in Malaysia. Malaysia is geographically divided into West and East Malaysia. In Sabah, a state in East Malaysia, there are over 1000 estimated cases of β-thalassemia major patients. Accurate population frequency data of the molecular basis of β-thalassemia major are needed for planning its control in the high-risk population of Sabah. Characterization of β-globin gene defects was done in 252 transfusion dependent β-thalassemia patients incorporating few PCR techniques. The study demonstrates that β-thalassemia mutations inherited are ethnically dependent. It is important to note that 86.9% of transfusion-dependent β-thalassemia major patients in Sabah were of the indigenous population and homozygous for a single mutation. The Filipino β(0)-deletion was a unique mutation found in the indigenous population of Sabah. Mutations common in West Malaysia were found in 11 (4.3%) patients. Four rare mutations (Hb Monroe, CD 8/9, CD 123/124/125 and IVS I-2) were also found. This study is informative on the population genetics of β-thalassemia major in Sabah.
  13. Mesenchymal stem cells of human placenta and umbilical cord suppress T-cell proliferation at G0 phase of cell cycle
    Vellasamy S, Sandrasaigaran P, Vidyadaran S, Abdullah M, George E, Ramasamy R
    Cell Biol Int, 2013 Mar;37(3):250-6.
    PMID: 23364902 DOI: 10.1002/cbin.10033
    Mesenchymal stem cells (MSC) generated from human umbilical cord (UC-MSC) and placenta (PLC-MSC) were assessed and compared for their immunomodulatory function on T cells proliferation by analysis of the cell cycle. Mitogen stimulated or resting T cells were co-cultured in the presence or absence of MSC. T-cell proliferation was assessed by tritiated thymidine ((3) H-TdR) assay and the mechanism of inhibition was examined bycell cycle and apoptosis assay. Both UC-MSC and PLC-MSC profoundly inhibited the proliferation of T-cell, mainly via cell-to-cell contact. MSC-mediated anti-proliferation does not lead to apoptosis,but prevented T cells from entering S phase and they therefore accumulated in the G(0) /G(1) phases. The anti-proliferative activity of MSC was related to this cell cycle arrest of T-cell. UC-MSC produced a greater inhibition than PLC-MSC in all measured parameters.
  14. Isolation and characterisation of mesenchymal stem cells derived from human placenta tissue
    Vellasamy S, Sandrasaigaran P, Vidyadaran S, George E, Ramasamy R
    World J Stem Cells, 2012 Jun 26;4(6):53-61.
    PMID: 22993662
    To explore the feasibility of placenta tissue as a reliable and efficient source for generating mesenchymal stem cells (MSC).
  15. Interaction of Hb South Florida (codon 1; GTG-->ATG) and HbE, with beta-thalassemia (IVS1-1; G-->A): expression of different clinical phenotypes
    Tan JA, Tan KL, Omar KZ, Chan LL, Wee YC, George E
    Eur J Pediatr, 2009 Sep;168(9):1049-54.
    PMID: 19034506 DOI: 10.1007/s00431-008-0877-9
    INTRODUCTION: Interactions of different hemoglobin variants with thalassemia alleles can result in various clinical phenotypes. HbE-beta-thalassemia generally manifests with severe anemia where individuals exhibit beta-thalassemia major with regular blood transfusions or beta-thalassemia intermedia with periodic blood transfusions. This study presents a unique Malay family with three beta-globin gene defects-HbE, Hb South Florida, and IVS1-1 (G-->A).

    MATERIALS AND METHODS: HbE activates a cryptic splice site that produces non-functional mRNAs. Hb South Florida is a rare beta-hemoglobin variant, and its interactions with other beta-thalassemia alleles have not been reported. IVS1-1 is a Mediterranean mutation that affects mRNA processing giving rise to beta(o)-thalassemia.

    RESULTS AND DISCUSSION: Fifteen mutations along the beta-globin gene complex were analyzed using the amplification refractory mutation system. Hb South Florida was identified by direct sequencing using genomic DNA.

    CONCLUSION: The affected child with HbE/IVS1-1 produced a beta-thalassemia major phenotype. Compound heterozygosity for Hb South Florida/IVS1-1 produced a beta-thalassemia carrier phenotype in the mother.

  16. Human mesenchymal stem cells protect neutrophils from serum-deprived cell death
    Maqbool M, Vidyadaran S, George E, Ramasamy R
    Cell Biol Int, 2011 Dec;35(12):1247-51.
    PMID: 21649586 DOI: 10.1042/CBI20110070
    We have previously shown that human MSC (mesenchymal stem cells) inhibit the proliferation of most of the immune cells. However, there are innate immune cells such as neutrophils and other PMN (polymorphonuclear) cells that do not require an extensive proliferation prior to their effector function. In this study, the effect of MSC on neutrophils in the presence of complete and serum-deprived culture media was investigated. In the presence of MSC, the viability of neutrophils increase as measured in 24 h of incubation at various supplementation of serum concentration. We have utilized Annexin V and PI (propidium iodide) staining to confirm whether the enhancement of neutrophil's viability is due to a reduction in PCD (programmed cell death). MSC significantly rescue neutrophils from apoptosis at 1, 5 and 10% of FBS (fetal bovine serum) supplementation. The fractions of viable and dead cells were increased and decreased respectively in the presence of MSC. Our results indicate MSC rescue neutrophils from nutrient- or serum-deprived cell death. However, whether this effect is exerted through a specific signalling pathway or confining neutrophils in resting state by MSC requires further investigation.
  17. Fulltext High throughput molecular confirmation of β-thalassemia mutations using novel TaqMan probes
    Kho SL, Chua KH, George E, Tan JA
    Sensors (Basel), 2013;13(2):2506-14.
    PMID: 23429513 DOI: 10.3390/s130202506
    β-Thalassemia is a public health problem where 4.5% of Malaysians are β-thalassemia carriers. The genetic disorder is caused by defects in the β-globin gene complex which lead to reduced or complete absence of β-globin chain synthesis. Five TaqMan genotyping assays were designed and developed to detect the common β-thalassemia mutations in Malaysian Malays. The assays were evaluated with 219 "blinded" DNA samples and the results showed 100% sensitivity and specificity. The in-house designed TaqMan genotyping assays were found to be cost- and time-effective for characterization of β-thalassemia mutations in the Malaysian population. 
  18. Fulltext High prevalence of alpha- and beta-thalassemia in the Kadazandusuns in East Malaysia: challenges in providing effective health care for an indigenous group
    Tan JA, Lee PC, Wee YC, Tan KL, Mahali NF, George E, et al.
    J Biomed Biotechnol, 2010;2010.
    PMID: 20871816 DOI: 10.1155/2010/706872
    Thalassemia can lead to severe transfusion-dependent anemia, and it is the most common genetic disorder in Malaysia. This paper aims to determine the prevalence of thalassemia in the Kadazandusuns, the largest indigenous group in Sabah, East Malaysia. α- and β-thalassemia were confirmed in 33.6% and 12.8%, of the individuals studied respectively. The high prevalence of α- and β-thalassemia in the Kadazandusuns indicates that thalassemia screening, genetic counseling, and prenatal diagnosis should be included as part of their healthcare system. This preliminary paper serves as a baseline for further investigations into the health and genetic defects of the major indigenous population in Sabah, East Malaysia.
  19. Fulltext Haemoglobin Lepore in a Malay family: a case report
    Pasangna J, George E, Nagaratnam M
    Malays J Pathol, 2005 Jun;27(1):33-7.
    PMID: 16676691
    A 2-year-old Malay boy was brought to the University Malaya Medical Centre for thalassaemia screening. Physical examination revealed thalassaemia facies, pallor, mild jaundice, hepatomegaly and splenomegaly. Laboratory investigations on the patient including studies on the parents lead to a presumptive diagnosis of homozygous Haemoglobin Lepore (Hb Lepore). The aim of this paper is to increase awareness of this rare disorder, this being the first case documented in Malaysia in a Malay. The case also demonstrates the need for this disorder to be included in the differential diagnosis of patients presenting clinically like thalassemia intermedia or thalassemia major. Accurate diagnosis would provide information necessary for prenatal diagnosis, proper clinical management and genetic counseling. The clinical, haematological and laboratory features of this disorder are discussed in this paper.
  20. Fulltext Genotype-phenotype diversity of beta-thalassemia in Malaysia: treatment options and emerging therapies
    George E, Ann TJ
    Med J Malaysia, 2010 Dec;65(4):256-60.
    PMID: 21901940 MyJurnal
    The haemoglobinopathies and thalassemias represent the most common inherited monogenic disorders in the world. Beta-thalassaemia major is an ongoing public health problem in Malaysia. Prior to 2004, the country had no national policy for screening and registry for thalassemia. In the absence of a national audit, the true figure of the extent of thalassemia in the Malaysian population was largely presumptive from micro-mapping studies from various research workers in the country. The estimated carrier rate for beta-thalassemia in Malaysia is 3.5-4%. There were 4768 transfusion dependent thalassemia major patients as of May 2010 (Data from National Thalassemia Registry).
Related Terms
Filters
Contact Us

Please provide feedback to Administrator (afdal@afpm.org.my)

External Links