Displaying publications 4101 - 4120 of 5776 in total

Abstract:
Sort:
  1. Daud MRHM, Yaacob NA, Arifin WN, Sani JAM, Ibadullah WAHW
    Osong Public Health Res Perspect, 2024 Oct;15(5):429-439.
    PMID: 39164020 DOI: 10.24171/j.phrp.2024.0156
    BACKGROUND: Despite effective vaccination strategies, measles remains a global public health challenge. The study explored individual and contextual factors associated with measles infection in Malaysia from 2018 to 2022, informing the development of targeted public health interventions.

    METHODS: This cross-sectional study utilised data from the Ministry of Health, the Department of Statistics, and the Department of Environment Malaysia. Multilevel logistic regression analysis was employed to examine individual-level factors, including age, sex, ethnicity, nationality, contact history, travel history, and vaccination status. Concurrently, contextual factors were assessed, encompassing district-level determinants such as population density, median household income, urbanisation, the number of health and rural clinics, vaccination rates, fine particulate matter less than 2.5 μm (PM2.5) levels, relative humidity, and temperature, to determine their impact on measles infection risk.

    RESULTS: Measles infection was significantly associated with various individual factors. These included age (adjusted odds ratio [aOR], 1.02; 95% confidence interval [CI], 1.02-1.03), ethnicity, non-Malaysian nationality (aOR, 34.53; 95% CI, 8.42- 141.51), prior contact with a measles case (aOR, 2.36; 95% CI, 2.07-2.69), travel history (aOR, 2.30; 95% CI, 1.13-4.70), and vaccination status (aOR, 0.76; 95% CI, 0.72-0.79). Among contextual factors, urbanisation (aOR, 1.56; 95% CI, 1.16- 2.10) and the number of clinics (aOR, 0.98; 95% CI, 0.97-0.99) were significant determinants.

    CONCLUSION: This multilevel logistic regression analysis illuminates the complexities of measles transmission, advocating public health interventions tailored to individual and contextual vulnerabilities. The findings highlight the need for a synergistic approach that combines vaccination campaigns, healthcare accessibility improvements, and socioeconomic interventions to effectively combat measles.

  2. Mydin MAO, Jagadesh P, Bahrami A, Majeed SS, Dulaimi A, Omar R
    Sci Rep, 2024 Aug 12;14(1):18733.
    PMID: 39134601 DOI: 10.1038/s41598-024-69572-4
    Improper waste management is causing global environmental problems. Waste glass may have adverse impacts on the ecosystem. While a substantial amount of soda-lime glass bottle (SGB) undergoes recycling to create new glass items, a significant volume still ends up in landfills. Therefore, the aim of this study was to explore the potential use of SGB in foamed concrete (FC) production as an aggregate replacement. SGB was substituted for sand in different weight fractions, ranging from 5 to 50%. The fresh state, mechanical, thermal, pore structure, and transport properties were examined. The findings showed a significant enhancement in the FC's mechanical properties when SGB replaced 20% of sand. The compressive, flexural, and splitting tensile strengths exhibited a rise of up to 17.7, 39.4, and 43.8%, respectively. The findings also demonstrated that the addition of SGB improved the thermal conductivity, sorptivity, water absorption, and porosity. The scanning electron microscopy analysis indicated that the inclusion of 20% SGB caused a substantial decrease in void diameter and enhanced its uniformity. A comparison was made between the experimental data and predictions of the mechanical properties using various models of international standards, such as IS 456, ACI 318, NZS-3101, EC-02, AS 3600, and CEB-FIB, along with several references in the literature. The findings implied a strong correlation between the strength properties. The outcomes of this research offer valuable insights into both the possible advantages and constraints of using SGB in FC. Furthermore, this extensive laboratory investigation may serve as a guideline for future study and aid in the advancement of greener and more environmentally friendly FC alternatives.
  3. Rohman A, Nawwaruddin HH, Hossain MAM, Laksitorini MD, Lestari D
    Open Vet J, 2024 Sep;14(9):2484-2492.
    PMID: 39553767 DOI: 10.5455/OVJ.2024.v14.i9.37
    BACKGROUND: Consumer awareness of food adulteration is increasing nowadays. Motivated by economic gain, unethical meat producers try to blend halal meat such as beef with non-halal meat like rat meat (RM).

    AIM: This study aims to develop a real-time polymerase chain reaction (RT-PCR) analysis method to analyze the presence of RM in beef meatballs.

    METHODS: This research was carried out in the following stages: primer design, DNA isolation, analysis of DNA isolates, the optimization of primer annealing temperature, primer specificity test, sensitivity, and repeatability. The validated RT-PCR method was then used to analyze the marketed meatball samples.

    RESULTS: The result showed that the designed primer targeting on ND2 gene set rat mt-DNA (forward: ACTCCATATCTCTCACCATATTTCC; reverse: GGGTTAGGGTACTTAGGATTGTTAG), had good specificity at an optimal annealing temperature of 56.3oC over the other eight species. The developed RT-PCR method produces a limit detection value of 195.31 pg, coefficient of determination (R 2) for linearity of 0.983, amplification efficiency (E) of 100%, and CV value for amplification response of 1.8%. The result showed that the developed RT-PCR method did not detect the presence of RM DNA in eight marketed beef meatball samples.

    CONCLUSION: The developed method meets the acceptance criteria for RT-PCR and can be used as a halal authentication method to identify the presence of RM in beef meatballs.

  4. Ariffin MFM, Rahman NNHA, Azid MAA, Ahmad K, Rosele MI, Harun MS
    J Relig Health, 2024 Dec;63(6):4354-4375.
    PMID: 36217041 DOI: 10.1007/s10943-022-01677-4
    The present work aimed to identify and describe the Malaysian Muslim community's understanding of health and cosmetic products related to the sunnah of Prophet Muhammad which are available in the Malaysian market. The demographics of this understanding are examined with respect to gender, age, marital and working status, highest level of education, and monthly income earned. A survey was conducted in 2017. A structured questionnaire pertaining to such products was used to capture the relevant data. This survey implemented a multistage design stratified by state, proportionate to the size of the state population, and was representative of the Malaysian population. Data analysis of the results was carried out using frequency and Chi-square analysis with the help of Statistical Packages for Social Science (SPSS) version 22.0. The paper concluded that the community's understanding of the term 'prophetic products' is that it refers to various products that Prophet Muhammad used and/or spoke of approvingly such as dates, raisins, pomegranates, honey, and others. It was observed that these ingredients were strongly identified in public perception as prophetic health and cosmetic products and that there is consequently great demand for these among Malaysians. This factor was identified through various elements. First, the combination of things recognized as prophetic items such as dates, raisins, pomegranates, honey, and others within the product. Second, the labeling of merchandise as prophetic products. Prophetic health merchandise was more popular among Malaysians than were cosmetic products.
  5. Brishty SR, Hossain MJ, Khandaker MU, Faruque MRI, Osman H, Rahman SMA
    Front Pharmacol, 2021;12:762807.
    PMID: 34803707 DOI: 10.3389/fphar.2021.762807
    Nowadays, nitrogenous heterocyclic molecules have attracted a great deal of interest among medicinal chemists. Among these potential heterocyclic drugs, benzimidazole scaffolds are considerably prevalent. Due to their isostructural pharmacophore of naturally occurring active biomolecules, benzimidazole derivatives have significant importance as chemotherapeutic agents in diverse clinical conditions. Researchers have synthesized plenty of benzimidazole derivatives in the last decades, amidst a large share of these compounds exerted excellent bioactivity against many ailments with outstanding bioavailability, safety, and stability profiles. In this comprehensive review, we have summarized the bioactivity of the benzimidazole derivatives reported in recent literature (2012-2021) with their available structure-activity relationship. Compounds bearing benzimidazole nucleus possess broad-spectrum pharmacological properties ranging from common antibacterial effects to the world's most virulent diseases. Several promising therapeutic candidates are undergoing human trials, and some of these are going to be approved for clinical use. However, notable challenges, such as drug resistance, costly and tedious synthetic methods, little structural information of receptors, lack of advanced software, and so on, are still viable to be overcome for further research.
  6. Hossain MA, Mohamed Iqbal MA, Julkapli NM, San Kong P, Ching JJ, Lee HV
    RSC Adv, 2018 Jan 29;8(10):5559-5577.
    PMID: 35542409 DOI: 10.1039/c7ra11824d
    Biomass-derived oils are recognised as the most promising renewable resources for the production of ester-based biolubricants due to their biodegradable, non-toxic and metal adhering properties. Homogeneous acid catalysts have been conventionally used in catalytic esterification and transesterification for the synthesis of ester-based biolubricants. Although homogeneous acid catalysts encounter difficulty during phase separation, they exhibit superior selectivity and good stereochemistry and regiochemistry control in the reaction. Consequently, transition metal complex catalysts (also known as homogeneous organometallic catalysts) are proposed for biolubricant synthesis in order to achieve a higher selectivity and conversion. Herein, the potential of both homogeneous transition metal complexes and heterogeneous supported metal complexes towards the synthesis of biolubricants, particularly, in esterification and transesterification, as well as the upgrading process, including hydrogenation and in situ hydrogenation-esterification, is critically reviewed.
  7. Naomi R, Bahari H, Yazid MD, Othman F, Zakaria ZA, Hussain MK
    Int J Mol Sci, 2021 Oct 06;22(19).
    PMID: 34639164 DOI: 10.3390/ijms221910816
    Hyperglycemia is a condition with high glucose levels that may result in dyslipidemia. In severe cases, this alteration may lead to diabetic retinopathy. Numerous drugs have been approved by officials to treat these conditions, but usage of any synthetic drugs in the long term will result in unavoidable side effects such as kidney failure. Therefore, more emphasis is being placed on natural ingredients due to their bioavailability and absence of side effects. In regards to this claim, promising results have been witnessed in the usage of Ipomoea batatas (I. batatas) in treating the hyperglycemic and dyslipidemic condition. Thus, the aim of this paper is to conduct an overview of the reported effects of I. batatas focusing on in vitro and in vivo trials in reducing high glucose levels and regulating the dyslipidemic condition. A comprehensive literature search was performed using Scopus, Web of Science, Springer Nature, and PubMed databases to identify the potential articles on particular topics. The search query was accomplished based on the Boolean operators involving keywords such as (1) Beneficial effect OR healing OR intervention AND (2) sweet potato OR Ipomoea batatas OR traditional herb AND (3) blood glucose OR LDL OR lipid OR cholesterol OR dyslipidemia. Only articles published from 2011 onwards were selected for further analysis. This review includes the (1) method of intervention and the outcome (2) signaling mechanism involved (3) underlying mechanism of action, and the possible side effects observed based on the phytoconstiuents isolated. The comprehensive literature search retrieved a total of 2491 articles using the appropriate keywords. However, on the basis of the inclusion and exclusion criteria, only 23 articles were chosen for further review. The results from these articles indicate that I. batatas has proven to be effective in treating the hyperglycemic condition and is able to regulate dyslipidemia. Therefore, this systematic review summarizes the signaling mechanism, mechanism of action, and phytoconstituents responsible for those activities of I. batatas in treating hyperglycemic based on the in vitro and in vivo study.
  8. Lee CZ, Zoqratt MZHM, Phipps ME, Barr JJ, Lal SK, Ayub Q, et al.
    Sci Rep, 2022 Feb 03;12(1):1824.
    PMID: 35115615 DOI: 10.1038/s41598-022-05656-3
    The human gut contains a complex microbiota dominated by bacteriophages but also containing other viruses and bacteria and fungi. There are a growing number of techniques for the extraction, sequencing, and analysis of the virome but currently no standardized protocols. This study established an effective workflow for virome analysis to investigate the virome of stool samples from two understudied ethnic groups from Malaysia: the Jakun and Jehai Orang Asli. By using the virome extraction and analysis workflow with the Oxford Nanopore Technology, long-read sequencing successfully captured close to full-length viral genomes. The virome composition of the two indigenous Malaysian communities were remarkably different from those found in other parts of the world. Additionally, plant viruses found in the viromes of these individuals were attributed to traditional food-seeking methods. This study establishes a human gut virome workflow and extends insights into the healthy human gut virome, laying the groundwork for comparative studies.
  9. Hasan MM, Madhavan P, Ahmad Noruddin NA, Lau WK, Ahmed QU, Arya A, et al.
    Pharm Biol, 2023 Dec;61(1):1135-1151.
    PMID: 37497554 DOI: 10.1080/13880209.2023.2230251
    CONTEXT: Arjunolic acid (AA) is a triterpenoid saponin found in Terminalia arjuna (Roxb.) Wight & Arn. (Combretaceae). It exerts cardiovascular protective effects as a phytomedicine. However, it is unclear how AA exerts the effects at the molecular level.

    OBJECTIVE: This study investigates the cardioprotective effects of arjunolic acid (AA) via MyD88-dependant TLR4 downstream signaling marker expression.

    MATERIALS AND METHODS: The MTT viability assay was used to assess the cytotoxicity of AA. LPS induced in vitro cardiovascular disease model was developed in H9C2 and C2C12 myotubes. The treatment groups were designed such as control (untreated), LPS control, positive control (LPS + pyrrolidine dithiocarbamate (PDTC)-25 µM), and treatment groups were co-treated with LPS and three concentrations of AA (50, 75, and 100 µM) for 24 h. The changes in the expression of TLR4 downstream signaling markers were evaluated through High Content Screening (HCS) and Western Blot (WB) analysis.

    RESULTS: After 24 h of co-treatment, the expression of TLR4, MyD88, MAPK, JNK, and NF-κB markers were upregulated significantly (2-6 times) in the LPS-treated groups compared to the untreated control in both HCS and WB experiments. Evidently, the HCS analysis revealed that MyD88, NF-κB, p38, and JNK were significantly downregulated in the H9C2 myotube in the AA treated groups. In HCS, the expression of NF-κB was downregulated in C2C12. Additionally, TLR4 expression was downregulated in both H9C2 and C2C12 myotubes in the WB experiment.

    DISCUSSION AND CONCLUSIONS: TLR4 marker expression in H9C2 and C2C12 myotubes was subsequently decreased by AA treatment, suggesting possible cardioprotective effects of AA.

  10. Pervez MN, Yeo WS, Lin L, Xiong X, Naddeo V, Cai Y
    Sci Rep, 2023 Jul 31;13(1):12363.
    PMID: 37524835 DOI: 10.1038/s41598-023-39528-1
    The typical textile dyeing process calls for a wide range of operational parameters, and it has always been difficult to pinpoint which of these qualities is the most important in dyeing performance. Consequently, this research used a combined design of experiments and machine learning prediction models' method to offer a sustainable and beneficial reactive cotton fabric dyeing process. To be more precise, we built a least square support vector regression (LSSVR) model based on Taguchi's statistical orthogonal design (L27) to predict exhaustion percentage (E%), fixation rate (F%), and total fixation efficiency (T%) and color strength (K/S) in the reactive cotton dyeing process. The model's prediction accuracy was assessed using many measures, including root mean square error (RMSE), mean absolute error (MAE), and the coefficient of determination (R2). Principal component regression (PCR), partial least square regression (PLSR), and fuzzy modelling were some of the other types of regression models used to compare results. Our findings reveal that the LSSVR model greatly outperformed competing models in predicting the E%, F%, T%, and K/S. This is shown by the LSSVR model's much smaller RMSE and MAE values. Overall, it provided the highest possible R2 values, which reached 0.9819.
  11. Abraham RE, Min GL, Pauzi ALBM, Salim NHA, Ismail I
    Turk J Emerg Med, 2023;23(3):191-194.
    PMID: 37529792 DOI: 10.4103/2452-2473.367398
    Respiratory myoclonus, also known as belly dancer's dyskinesia (BDD), is a rare manifestation of movement disorder characterized by repetitive choreiform involuntary movements involving the anterior abdominal muscles, the diaphragm, and other respiratory muscles. Currently, there is no definite pathophysiology that clearly explains this condition. A 25-year-old male with a known case of BDD presented with an exacerbation of involuntary and continuous writhing movements of the abdominal wall muscles associated with abdominal pain and shortness of breath over the past 2 days. Subsequently, he was intubated due to worsening respiratory distress a few days after his admission. He was then put on ultrasound-guided botulinum toxin A injections of 25 units over the left hemidiaphragm regularly. His symptoms markedly improved since then as the attacks had reduced to 5-6 monthly intervals. Administration of ultrasound-guided botulinum toxin A injections may help to control the exacerbation of BDD and might be an option for cases refractory to medical treatment and phrenic nerve ablation.
  12. Mistry H, Fernandes S, Haq MA, Bafna Y, Bhatt R, Sinha S, et al.
    Cureus, 2023 Aug;15(8):e43748.
    PMID: 37600432 DOI: 10.7759/cureus.43748
    INTRODUCTION: Exploring routes of needle-free anesthesia has drawn particular attention to the iontophoretic technique. Iontophoresis has a wide range of applications in dentistry, treating hypersensitivity, oral ulcers, non-invasive procedures of deep topical anesthesia, etc. Hence, this research was performed for a comparative assessment of topical anesthesia spray infused via iontophoresis and local anesthesia (LA) infiltration for dental procedures among 5-12-year-old patients.

    MATERIALS AND METHODS: A split-mouth, randomized clinical trial was undertaken over two years among study subjects aged 5 to 12 years. They were randomly assigned to one of two groups: the first (Group A - iontophoresis group) received topical anesthesia spray (Lidayn®; Pyrax Polymers, Roorkee, India) applied by iontophoresis, and the second (Group B - LA infiltration group) received local infiltration of 2% lignocaine solution (LignoTer®; Lusture Pharma, Ahmedabad, India), where primary teeth extraction or pulpectomy was performed. The Wong-Baker Facial Pain Rating Scale (WBFPRS) was used for a subjective assessment immediately following anesthesia.

    RESULTS: The mean value of current intensity for the extraction procedure was 9.43±0.95 mA, and the duration of application was 1.85±0.80 minutes. The mean value of current intensity for pulpectomy was 9.07±1.34 mA, and the time was 2.40±0.74 minutes. In inter-group comparison, WBFPRS scores were lower in Group A (1.96±1.64) compared to Group B (3.62±1.11), which was statistically significant with p=0.001.

    CONCLUSION: Compared to local infiltration, iontophoresis as a non-invasive approach for topical anesthesia was more well-received by pediatric patients.

  13. Karim MR, Zakaria Z, Hassan L, Faiz NM, Ahmad NI
    Front Microbiol, 2023;14:1208314.
    PMID: 37601372 DOI: 10.3389/fmicb.2023.1208314
    The advent of antimicrobials-resistant (AMR), including colistin-resistant bacteria, poses a significant challenge to animal and human health, food safety, socio-economic growth, and the global environment. This study aimed to ascertain the colistin resistance prevalence and molecular mechanisms of colistin resistance in Enterobacteriaceae. The colistin resistance was determined using broth microdilution assay, PCR; and Sanger sequencing of mcr genes responsible for colistin resistance in Enterobacteriaceae (n = 627), including Escherichia coli (436), Salmonella spp. (n = 140), and Klebsiella pneumoniae (n = 51), obtained from chicken and chicken meats. Out of 627 Enterobacteriaceae, 8.6% of isolates exhibited colistin resistance phenotypically. Among these colistin resistant isolates, 9.3% (n = 37) were isolated from chicken meat, 7.2% (n = 11) from the cloacal swab of chicken and 7.9% (n = 6) from the litter samples. Overall, 12.96% of colistin-resistant isolates were positive with mcr genes, in which mcr-1 and mcr-5 genes were determined in 11.11% and 1.85% of colistin-resistant isolates, respectively. The E. coli isolates obtained from chicken meats, cloacal swabs and litter samples were found positive for mcr-1, and Salmonella spp. originated from the chicken meat sample was observed with mcr-5, whereas no mcr genes were observed in K. pneumoniae strains isolated from any of the collected samples. The other colistin resistance genes, including mcr-2, mcr-3, mcr-4, mcr-6, mcr-7, mcr-8, mcr-9, and mcr-10 were not detected in the studied samples. The mcr-1 and mcr-5 genes were sequenced and found to be 100% identical to the mcr-1 and mcr-5 gene sequences available in the NCBI database. This is the first report of colistin resistance mcr-5 gene in Malaysia which could portend the emergence of mcr-5 harboring bacterial strains for infection. Further studies are needed to characterize the mr-5 harbouring bacteria for the determination of plasmid associated with mcr-5 gene.
  14. Patel B, Joshi S, Nagrani T, Girdhar GA, Patel H, Sinha S, et al.
    Cureus, 2023 Aug;15(8):e44394.
    PMID: 37654905 DOI: 10.7759/cureus.44394
    Introduction This study aims to differentiate the employment of demineralized bone matrix (DMBM; Osseograft, Advanced Biotech Products (P) Ltd, Chennai, India) and platelet-rich fibrin (PRF) alone to a composite graft consisting of both materials in the surgical actions toward the anomalies of the human periodontal furcation imperfection. Methods In a split-mouth study, 30 patients with mandibular molars affected by the furcation were allocated without conscious choice to test (PRF + DMBM, n = 30) or control (PRF, n = 30) categories. At the starting point, three months after surgery, and six months later, the following modifiable factors were evaluated: probing pocket depth (PPD), full-mouth plaque scores, full-mouth gingival scores, radiographic defect depth, relative vertical clinical attachment level (RVCAL), and relative horizontal clinical attachment level (RHCAL). Results Results at three and six months demonstrated substantial differences between baseline values for both treatment methods in clinical and X-ray imaging appraisal. Nonetheless, the PRF/DMBM group manifests statistically significantly soaring changes observed in comparison to the PRF group. Overall, the probing depth (PD) in the test site was significantly lower than that in the control site, showing a reduction of 68% (95% CI=41%, 95%, p<0.001). Conclusion Clinical indications significantly improved with PRF and DMBM combined instead of PRF alone. On radiographs, the test group also showed higher bone fill.
  15. Zaini MA, Mohd Zain A, Din NM, Mustapha M, Sidi H
    PLoS One, 2023;18(8):e0290260.
    PMID: 37624864 DOI: 10.1371/journal.pone.0290260
    BACKGROUND: Since the enforcement of the Movement Control Order (MCO) to contain the spread of COVID -19 infection in Malaysia, most clinic appointments have been rescheduled and procedures and surgeries postponed to a later date. Clinic appointments including intravitreal endothelial growth factor (anti-VEGF) treatment for patients with diabetic macular edema (DME) were also no exception to the postponement. This measure takes a psychological toll on patients because of the overwhelming concern for their eye condition. This study was conducted to assess the psychological status of DME patients with delayed anti-VEGF treatment during the pandemic.

    METHODS: A cross-sectional study was conducted from September 2020 to March 2021 in Ophthalmology Clinic Hospital Canselor Tuanku Muhriz Universiti Kebangsaan Malaysia (HCTM UKM). Subjects diagnosed with center-involved DME aged between 20 to 80 years who experienced delayed anti-VEGF injection were recruited. Level of depression, anxiety and stress were assessed using DASS-21 questionnaire. Statistical analysis using non-parametric tests were performed to determine the relationship between the DASS-21 score and duration of last injection, in those whose vision was affected by delayed injection and the relationship to the impact of COVID-19 pandemic. Statistical significance was denoted as p < 0.05.

    RESULTS: A total of 86 respondents with median age of 69 years old participated in this study. Most respondents were Malays (n = 47,54.7%) males (n = 51, 59.3%), had education up to secondary level (n = 37, 43%), unemployed (n = 78, 90.7%), married (n = 72, 83.7%) and living with their family (n = 82, 95.3%). The number of intravitreal injections received was at least three times among the respondents (n = 81, 94.2%). More than half of the respondents (n = 46, 53.5%) had been postponed for more than 12 weeks and felt that their vision was affected after delayed intravitreal injection (n = 47, 54.7%). Most of the subjects did not experience depression, anxiety, or stress. However, there was a significant level of stress scores among those with delayed injection of 9 to 12 weeks (p = 0.004), and significant anxiety (p = 0.029) and stress (p = 0.014) scores found in subjects with vision affected due to delayed treatment.

    CONCLUSION: The level of anxiety and stress can be significant in DME patients who experienced delay in intravitreal anti-VEGF treatment. Assessment of psychosocial impacts is important to identify early mental health issues potentially leading to the onset of psychiatry illness, thus early intervention is indispensable.

  16. Islam MS, Kasim S, Amin AM, Alam MK, Khatun MF, Ahmed S, et al.
    PLoS One, 2023;18(8):e0285954.
    PMID: 37643156 DOI: 10.1371/journal.pone.0285954
    Foliar fertilization is a reliable technique for correcting a nutrient deficiency in plants caused by inadequate nutrient supply to the roots in acid soil. Soluble nutrients in banana pseudostem sap might be effective to supplement chemical fertilizers. However, the limited nutrients in sole banana pseudostem sap as foliar fertilization may not meet-up the nutritional demand of the crop. Field trials were, therefore, conducted with the combination of soil-applied fertilizers with foliar spray of banana pseudostem sap to increase nutrient uptake, yield, and quality of sweet corn planted in acidic soil. Three treatments viz., 100% recommended dose of fertilizers (RD) as control (T1), 75% of RD applied in soil with foliar application of non-enriched banana pseudostem sap (T2), and 50% RD applied in soil with foliar spray of enriched banana pseudostem sap (T3) were replicated four times. The combination of soil-applied fertilizer with foliar spray of enriched banana pseudostem sap (T3) showed a significant increase in leaf area index (11.3%), photosynthesis (12%), fresh cob yield (39%), and biomass of corn (29%) over control. Besides, the 50% RD of soil fertilization with foliar spray of enriched pseudostem sap increased nutrient uptake in addition to an increase in sugar content, phenolic content, soluble protein, and amino acids of corn. Considering the economic analysis, the highest net income, BCR (3.74) and MBCR (1.25) values confirmed the economic viability of T3 treatment over the T1. The results suggest that foliar spray of enriched banana pseudostem sap can be used as a supplementary source of nutrients to enhance nutrient uptake by corn while increasing yield and minimizing chemical fertilizer use in acid soil.
  17. Chan YB, Aminuzzaman M, Tey LH, Win YF, Watanabe A, Djearamame S, et al.
    Materials (Basel), 2023 Aug 02;16(15).
    PMID: 37570124 DOI: 10.3390/ma16155421
    Compared to conventional metal oxide nanoparticles, metal oxide nanocomposites have demonstrated significantly enhanced efficiency in various applications. In this study, we aimed to synthesize zinc oxide-copper oxide nanocomposites (ZnO-CuO NCs) using a green synthesis approach. The synthesis involved mixing 4 g of Zn(NO3)2·6H2O with different concentrations of mangosteen (G. mangostana) leaf extract (0.02, 0.03, 0.04 and 0.05 g/mL) and 2 or 4 g of Cu(NO3)2·3H2O, followed by calcination at temperatures of 300, 400 and 500 °C. The synthesized ZnO-CuO NCs were characterized using various techniques, including a UV-Visible spectrometer (UV-Vis), photoluminescence (PL) spectroscopy, Fourier Transform Infrared (FTIR) spectroscopy, X-ray powder diffraction (XRD) analysis and Field Emission Scanning Electron Microscope (FE-SEM) with an Energy Dispersive X-ray (EDX) analyzer. Based on the results of this study, the optical, structural and morphological properties of ZnO-CuO NCs were found to be influenced by the concentration of the mangosteen leaf extract, the calcination temperature and the amount of Cu(NO3)2·3H2O used. Among the tested conditions, ZnO-CuO NCs derived from 0.05 g/mL of mangosteen leaf extract, 4 g of Zn(NO3)2·6H2O and 2 g of Cu(NO3)2·3H2O, calcinated at 500 °C exhibited the following characteristics: the lowest energy bandgap (2.57 eV), well-defined Zn-O and Cu-O bands, the smallest particle size of 39.10 nm with highest surface area-to-volume ratio and crystalline size of 18.17 nm. In conclusion, we successfully synthesized ZnO-CuO NCs using a green synthesis approach with mangosteen leaf extract. The properties of the nanocomposites were significantly influenced by the concentration of the plant extract, the calcination temperature and the amount of precursor used. These findings provide valuable insights for researchers seeking innovative methods for the production and utilization of nanocomposite materials.
  18. Azman SS, Yazid MD, Abdul Ghani NA, Raja Sabudin RZA, Abdul Rahman MR, Sulaiman N
    Artif Cells Nanomed Biotechnol, 2023 Dec;51(1):408-416.
    PMID: 37584645 DOI: 10.1080/21691401.2023.2245456
    Endothelial dysfunction initiates the pathogenesis of a myriad of cardiovascular diseases, yet the precise underlying mechanisms remain unclear. Current model utilises mechanical denudation of arteries resulting in an arterial-injury model with onset of intimal hyperplasia (IH). Our study shows that 5 min enzymatic denudation of human umbilical artery (hUA) lumen at 37 °C efficiently denudes hUA while maintaining vessel integrity without significantly increase intima-media thickness after 7 days in culture. This ex-vivo model will be a valuable tool in understanding the mechanism of re-endothelialization prior to smooth muscle cells (SMC) activation thus placating IH at an early stage.
  19. van der Ent A, Mak R, de Jonge MD, Harris HH
    Sci Rep, 2018 Jun 26;8(1):9683.
    PMID: 29946061 DOI: 10.1038/s41598-018-26891-7
    Hyperaccumulation is generally highly specific for a single element, for example nickel (Ni). The recently-discovered hyperaccumulator Glochidion cf. sericeum (Phyllanthaceae) from Malaysia is unusual in that it simultaneously accumulates nickel and cobalt (Co) with up to 1500 μg g-1 foliar of both elements. We set out to determine whether distribution and associated ligands for Ni and Co complexation differ in this species. We postulated that Co hyperaccumulation coincides with Ni hyperaccumulation operating on similar physiological pathways. However, the ostensibly lower tolerance for Co at the cellular level results in the exudation of Co on the leaf surface in the form of lesions. The formation of such lesions is akin to phytotoxicity responses described for manganese (Mn). Hence, in contrast to Ni, which is stored principally inside the foliar epidermal cells, the accumulation response to Co consists of an extracellular mechanism. The chemical speciation of Ni and Co, in terms of the coordinating ligands involved and principal oxidation state, is similar and associated with carboxylic acids (citrate for Ni and tartrate or malate for Co) and the hydrated metal ion. Some oxidation to Co3+, presumably on the surface of leaves after exudation, was observed.
  20. Karim ME, Tha KK, Othman I, Borhan Uddin M, Chowdhury EH
    Pharmaceutics, 2018 May 26;10(2).
    PMID: 29861465 DOI: 10.3390/pharmaceutics10020065
    RNA Interference (RNAi) has brought revolutionary transformations in cancer management in the past two decades. RNAi-based therapeutics including siRNA and shRNA have immense scope to silence the expression of mutant cancer genes specifically in a therapeutic context. Although tremendous progress has been made to establish catalytic RNA as a new class of biologics for cancer management, a lot of extracellular and intracellular barriers still pose a long-lasting challenge on the way to clinical approval. A series of chemically suitable, safe and effective viral and non-viral carriers have emerged to overcome physiological barriers and ensure targeted delivery of RNAi. The newly invented carriers, delivery techniques and gene editing technology made current treatment protocols stronger to fight cancer. This review has provided a platform about the chronicle of siRNA development and challenges of RNAi therapeutics for laboratory to bedside translation focusing on recent advancement in siRNA delivery vehicles with their limitations. Furthermore, an overview of several animal model studies of siRNA- or shRNA-based cancer gene therapy over the past 15 years has been presented, highlighting the roles of genes in multiple cancers, pharmacokinetic parameters and critical evaluation. The review concludes with a future direction for the development of catalytic RNA vehicles and design strategies to make RNAi-based cancer gene therapy more promising to surmount cancer gene delivery challenges.
Filters
Contact Us

Please provide feedback to Administrator (afdal@afpm.org.my)

External Links