METHODS: This cross-sectional study utilised data from the Ministry of Health, the Department of Statistics, and the Department of Environment Malaysia. Multilevel logistic regression analysis was employed to examine individual-level factors, including age, sex, ethnicity, nationality, contact history, travel history, and vaccination status. Concurrently, contextual factors were assessed, encompassing district-level determinants such as population density, median household income, urbanisation, the number of health and rural clinics, vaccination rates, fine particulate matter less than 2.5 μm (PM2.5) levels, relative humidity, and temperature, to determine their impact on measles infection risk.
RESULTS: Measles infection was significantly associated with various individual factors. These included age (adjusted odds ratio [aOR], 1.02; 95% confidence interval [CI], 1.02-1.03), ethnicity, non-Malaysian nationality (aOR, 34.53; 95% CI, 8.42- 141.51), prior contact with a measles case (aOR, 2.36; 95% CI, 2.07-2.69), travel history (aOR, 2.30; 95% CI, 1.13-4.70), and vaccination status (aOR, 0.76; 95% CI, 0.72-0.79). Among contextual factors, urbanisation (aOR, 1.56; 95% CI, 1.16- 2.10) and the number of clinics (aOR, 0.98; 95% CI, 0.97-0.99) were significant determinants.
CONCLUSION: This multilevel logistic regression analysis illuminates the complexities of measles transmission, advocating public health interventions tailored to individual and contextual vulnerabilities. The findings highlight the need for a synergistic approach that combines vaccination campaigns, healthcare accessibility improvements, and socioeconomic interventions to effectively combat measles.
AIM: This study aims to develop a real-time polymerase chain reaction (RT-PCR) analysis method to analyze the presence of RM in beef meatballs.
METHODS: This research was carried out in the following stages: primer design, DNA isolation, analysis of DNA isolates, the optimization of primer annealing temperature, primer specificity test, sensitivity, and repeatability. The validated RT-PCR method was then used to analyze the marketed meatball samples.
RESULTS: The result showed that the designed primer targeting on ND2 gene set rat mt-DNA (forward: ACTCCATATCTCTCACCATATTTCC; reverse: GGGTTAGGGTACTTAGGATTGTTAG), had good specificity at an optimal annealing temperature of 56.3oC over the other eight species. The developed RT-PCR method produces a limit detection value of 195.31 pg, coefficient of determination (R 2) for linearity of 0.983, amplification efficiency (E) of 100%, and CV value for amplification response of 1.8%. The result showed that the developed RT-PCR method did not detect the presence of RM DNA in eight marketed beef meatball samples.
CONCLUSION: The developed method meets the acceptance criteria for RT-PCR and can be used as a halal authentication method to identify the presence of RM in beef meatballs.
OBJECTIVE: This study investigates the cardioprotective effects of arjunolic acid (AA) via MyD88-dependant TLR4 downstream signaling marker expression.
MATERIALS AND METHODS: The MTT viability assay was used to assess the cytotoxicity of AA. LPS induced in vitro cardiovascular disease model was developed in H9C2 and C2C12 myotubes. The treatment groups were designed such as control (untreated), LPS control, positive control (LPS + pyrrolidine dithiocarbamate (PDTC)-25 µM), and treatment groups were co-treated with LPS and three concentrations of AA (50, 75, and 100 µM) for 24 h. The changes in the expression of TLR4 downstream signaling markers were evaluated through High Content Screening (HCS) and Western Blot (WB) analysis.
RESULTS: After 24 h of co-treatment, the expression of TLR4, MyD88, MAPK, JNK, and NF-κB markers were upregulated significantly (2-6 times) in the LPS-treated groups compared to the untreated control in both HCS and WB experiments. Evidently, the HCS analysis revealed that MyD88, NF-κB, p38, and JNK were significantly downregulated in the H9C2 myotube in the AA treated groups. In HCS, the expression of NF-κB was downregulated in C2C12. Additionally, TLR4 expression was downregulated in both H9C2 and C2C12 myotubes in the WB experiment.
DISCUSSION AND CONCLUSIONS: TLR4 marker expression in H9C2 and C2C12 myotubes was subsequently decreased by AA treatment, suggesting possible cardioprotective effects of AA.
MATERIALS AND METHODS: A split-mouth, randomized clinical trial was undertaken over two years among study subjects aged 5 to 12 years. They were randomly assigned to one of two groups: the first (Group A - iontophoresis group) received topical anesthesia spray (Lidayn®; Pyrax Polymers, Roorkee, India) applied by iontophoresis, and the second (Group B - LA infiltration group) received local infiltration of 2% lignocaine solution (LignoTer®; Lusture Pharma, Ahmedabad, India), where primary teeth extraction or pulpectomy was performed. The Wong-Baker Facial Pain Rating Scale (WBFPRS) was used for a subjective assessment immediately following anesthesia.
RESULTS: The mean value of current intensity for the extraction procedure was 9.43±0.95 mA, and the duration of application was 1.85±0.80 minutes. The mean value of current intensity for pulpectomy was 9.07±1.34 mA, and the time was 2.40±0.74 minutes. In inter-group comparison, WBFPRS scores were lower in Group A (1.96±1.64) compared to Group B (3.62±1.11), which was statistically significant with p=0.001.
CONCLUSION: Compared to local infiltration, iontophoresis as a non-invasive approach for topical anesthesia was more well-received by pediatric patients.
METHODS: A cross-sectional study was conducted from September 2020 to March 2021 in Ophthalmology Clinic Hospital Canselor Tuanku Muhriz Universiti Kebangsaan Malaysia (HCTM UKM). Subjects diagnosed with center-involved DME aged between 20 to 80 years who experienced delayed anti-VEGF injection were recruited. Level of depression, anxiety and stress were assessed using DASS-21 questionnaire. Statistical analysis using non-parametric tests were performed to determine the relationship between the DASS-21 score and duration of last injection, in those whose vision was affected by delayed injection and the relationship to the impact of COVID-19 pandemic. Statistical significance was denoted as p < 0.05.
RESULTS: A total of 86 respondents with median age of 69 years old participated in this study. Most respondents were Malays (n = 47,54.7%) males (n = 51, 59.3%), had education up to secondary level (n = 37, 43%), unemployed (n = 78, 90.7%), married (n = 72, 83.7%) and living with their family (n = 82, 95.3%). The number of intravitreal injections received was at least three times among the respondents (n = 81, 94.2%). More than half of the respondents (n = 46, 53.5%) had been postponed for more than 12 weeks and felt that their vision was affected after delayed intravitreal injection (n = 47, 54.7%). Most of the subjects did not experience depression, anxiety, or stress. However, there was a significant level of stress scores among those with delayed injection of 9 to 12 weeks (p = 0.004), and significant anxiety (p = 0.029) and stress (p = 0.014) scores found in subjects with vision affected due to delayed treatment.
CONCLUSION: The level of anxiety and stress can be significant in DME patients who experienced delay in intravitreal anti-VEGF treatment. Assessment of psychosocial impacts is important to identify early mental health issues potentially leading to the onset of psychiatry illness, thus early intervention is indispensable.