Eco-friendly pretreatment methods for lignocellulosic biomass are being developed as alternatives to chemical based methods. Superheated steam (SHS), hot compressed water (HCW) and wet disk milling (WDM) were used individually and with combination to partially remove hemicellulose and alter the lignin composition of recalcitrant structure of oil palm mesocarp fiber (OPMF). The efficiency of the pretreatment methods was evaluated based on the chemical compositions altered, SEM analysis, power consumption and degree of enzymatic digestibility. Hemicellulose removal (94.8%) was more pronounced under HCW compared to SHS, due to maximal contact of water and production of acetic acid which enhanced further degradation of hemicellulose. Subsequent treatment with WDM resulted in defibrillation of OPMF and expansion of the specific surface area thus increasing the conversion of cellulose to glucose. The highest glucose yield was 98.1% (g/g-substrate) when pretreated with HCW (200 °C, 20 min) and WDM which only consumed 9.6 MJ/kg of OPMF.
In this work, a genetic algorithm is applied for the automatic detection of oil spills. The procedure is implemented using sequences from RADARSAT-2 SAR ScanSAR Narrow single-beam data acquired in the Gulf of Mexico. The study demonstrates that the implementation of crossover allows for the generation of an accurate oil spill pattern. This conclusion is confirmed by the receiver-operating characteristic (ROC) curve. The ROC curve indicates that the existence of oil slick footprints can be identified using the area between the ROC curve and the no-discrimination line of 90%, which is greater than that of other surrounding environmental features. In conclusion, the genetic algorithm can be used as a tool for the automatic detection of oil spills, and the ScanSAR Narrow single-beam mode serves as an excellent sensor for oil spill detection and survey.
Age estimation was used in forensic anthropology to help in the identification of individual remains and living person. However, the estimation methods tend to be unique and applicable only to a certain population. This paper analyzed age estimation using twelve regression models carried out on X-ray images of the left hand taken from an Asian data set for subjects under the age of 19. All the nineteen bones of the left hand were measured using free image software and the statistical analysis were performed using SPSS. There are two methods to determine age in this study which are single bone method and all bones method. For single bone method, S-curve regression model was found to have the highest R-square value using second metacarpal for males, and third proximal phalanx for females. For age estimation using single bone, fifth metacarpal from males and fifth proximal phalanx from females can be used due to the lowest mean square error (MSE) value. To conclude, multiple linear regressions is the best techniques for age estimation in cases where all bones are available, but if not, S-curve regression can be used using single bone method.
Matched MeSH terms: Age Determination by Skeleton/methods*
Multi-walled carbon nanotubes (MWCNTs) were prepared via chemical vapor deposition (CVD) using a series of different catalysts, derived from FeCoNiAl, CoNiAl and FeNiAl layered double hydroxides (LDHs). Catalyst-active particles were obtained by calcination of LDHs at 800 °C for 5 h. Nitrogen and hexane were used as the carrier gas and carbon source respectively, for preparation of MWCNTs using CVD methods at 800 °C. MWCNTs were allowed to grow for 30 min on the catalyst spread on an alumina boat in a quartz tube. The materials were subsequently characterized through X-ray diffraction, Fourier transform infrared spectroscopy, surface area analysis, field emission scanning electron microscopy and transmission electron microscopy. It was determined that size and yield of MWCNTs varied depending on the type of LDH catalyst precursor that is used during synthesis. MWCNTs obtained using CoNiAl-LDH as the catalyst precursor showed smaller diameter and higher yield compared to FeCoNiAl and FeNiAl LDHs.
A recently reported stable and efficient EBPR system at high temperatures around 30 °C has led to characterization of kinetic and stoichiometric parameters of the Activated Sludge Model no. 2d (ASM2d). Firstly, suitable model parameters were selected by identifiability analysis. Next, the model was calibrated and validated. ASM2d was found to represent the processes well at 28 and 32 °C except in polyhyroxyalkanoate (PHA) accumulation of the latter. The values of the kinetic parameters for PHA storage (q PHA), polyphosphate storage (q PP) and growth (μ PAO) of polyphosphate-accumulating organisms (PAOs) at 28 and 32 °C were found to be much higher than those reported by previous studies. Besides, the value of the stoichiometric parameter for the requirement of polyphosphate for PHA storage (Y PO4) was found to decrease as temperature rose from 28 to 32 °C. Values of two other stoichiometric parameters, i.e. the growth yield of heterotrophic organisms (Y H) and PAOs (Y PAO), were high at both temperatures. These calibrated parameters imply that the extremely active PAOs of the study were able to store PHA, store polyphosphate and even utilize PHA for cell growth. Besides, the parameters do not follow the Arrhenius correlation due to the previously reported unique microbial clade at 28 and 32 °C, which actively performs EBPR at high temperatures.
Para-arsanilic acid (p-ASA) has been widely used in the poultry industry to promote growth and prevent dysentery. It is excreted unchanged in the manure and released into non-target sites causing organoarsenic pollution risk to the environment and living system. Therefore, simple and effective analytical strategies are demanded for determining the samples that contain p-ASA. However, direct determination of both p-ASA and ortho-arsanilic acid (o-ASA) using differential pulse cathodic stripping voltammetry (DPCSV) gives the similar voltammograms that directly hamper the analysis used by the DPCSV technique. In this study, a method to determine and differentiate p-ASA from o-ASA via diazotization and coupling reaction of the amine groups followed by the direct DPCSV determination of diazo compounds is presented. The diazotization reaction carried out at pH 1.5 and 0 ± 1°C for 10 min showed two reduction peaks in DPCSV at-70 mV and -440 mV vs. Ag/AgCl (KCl 3 M). However, when the diazotization reaction was performed at pH 12.5 and 0 ± 1°C for 40 min, a coloured azo compound was produced and the DPCSV showed only one reduction peak that appeared at -600 mV vs. Ag/AgCl (3 M of KCl). The results of this study show that only p-ASA compound gave a reduction peak, whereas o-ASA compound did not give any peak. The detection limit of p-ASA was found to be 4 × 10(-8 )M. As a result, the proposed electro-analytical technique might be a good candidate to determine and differentiate the p-ASA present in the poultry and environmental samples.
Today, people use the Internet to satisfy health-related information and communication needs. In Malaysia, Internet use for health management has become increasingly significant due to the increase in the incidence of chronic diseases, in particular among urban women and their desire to stay healthy. Past studies adopted the Technology Acceptance Model (TAM) and Health Belief Model (HBM) independently to explain Internet use for health-related purposes. Although both the TAM and HBM have their own merits, independently they lack the ability to explain the cognition and the related mechanism in which individuals use the Internet for health purposes.
The molecularly imprinted polymer (MIP) based on methacrylic acid functionalized β-cyclodextrin (MAA-β-CD) monomer was synthesized for the purpose of selective recognition of benzylparaben (BzP). The MAA-β-CD monomer was produced by bridging a methacrylic acid (MAA) and β-cyclodextrin (β-CD) using toluene-2,4-diisocyanate (TDI) by reacting the -OH group of MAA and one of the primary -OH groups of β-CD. This monomer comprised of triple interactions that included an inclusion complex, π-π interaction, and hydrogen bonding. To demonstrate β-CD performance in MIPs, two MIPs were prepared; molecularly imprinted polymer-methacrylic acid functionalized β-cyclodextrin, MIP(MAA-β-CD), and molecularly imprinted polymer-methacrylic acid, MIP(MAA); both prepared by a reversible addition fragmentation chain transfer polymerization (RAFT) in the bulk polymerization process. Both MIPs were characterized using the Fourier Transform Infrared Spectroscopy (FTIR), Field Emission Scanning Electron Microscopy (FESEM), and Brunauer-Emmett-Teller (BET). The presence of β-CD not only influenced the morphological structure, it also affected the specific surface area, average pore diameter, and total pore volume of the MIP. The rebinding of the imprinting effect was evaluated in binding experiments, which proved that the β-CD contributed significantly to the enhancement of the recognition affinity and selective adsorption of the MIP.
The FCGR3 locus encoding the low affinity activating receptor FcγRIII, plays a vital role in immunity triggered by cellular effector and regulatory functions. Copy number of the genes FCGR3A and FCGR3B has previously been reported to affect susceptibility to several autoimmune diseases and chronic inflammatory conditions. However, such genetic association studies often yield inconsistent results; hence require assays that are robust with low error rate. We investigated the accuracy and efficiency in estimating FCGR3 CNV by comparing Sequenom MassARRAY and paralogue ratio test-restriction enzyme digest variant ratio (PRT-REDVR). In addition, since many genetic association studies of FCGR3B CNV were carried out using real-time quantitative PCR, we have also included the evaluation of that method's performance in estimating the multi-allelic CNV of FCGR3B. The qPCR assay exhibited a considerably broader distribution of signal intensity, potentially introducing error in estimation of copy number and higher false positive rates. Both Sequenom and PRT-REDVR showed lesser systematic bias, but Sequenom skewed towards copy number normal (CN = 2). The discrepancy between Sequenom and PRT-REDVR might be attributed either to batch effects noise in individual measurements. Our study suggests that PRT-REDVR is more robust and accurate in genotyping the CNV of FCGR3, but highlights the needs of multiple independent assays for extensive validation when performing a genetic association study with multi-allelic CNVs.
Oil palm trunk (OPT) sap was utilized for growth and bioethanol production by Saccharomycescerevisiae with addition of palm oil mill effluent (POME) as nutrients supplier. Maximum yield (YP/S) was attained at 0.464g bioethanol/g glucose presence in the OPT sap-POME-based media. However, OPT sap and POME are heterogeneous in properties and fermentation performance might change if it is repeated. Contribution of parametric uncertainty analysis on bioethanol fermentation performance was then assessed using Monte Carlo simulation (stochastic variable) to determine probability distributions due to fluctuation and variation of kinetic model parameters. Results showed that based on 100,000 samples tested, the yield (YP/S) ranged 0.423-0.501g/g. Sensitivity analysis was also done to evaluate the impact of each kinetic parameter on the fermentation performance. It is found that bioethanol fermentation highly depend on growth of the tested yeast.
To describe the clinical findings, diagnostics, and differential diagnosis in a patient with retinopathy in acute systemic Epstein-Barr virus (EBV) infection.
The Austropotamobius pallipes complete mitogenome has been recovered using Next-Gen sequencing. Our sample of A. pallipes has a mitogenome of 15,679 base pairs (68.44% A + T content) made up of 13 protein-coding genes, 2 ribosomal subunit genes, 22 transfer RNAs, and a 877 bp non-coding AT-rich region. This is the first mitogenome sequenced for a crayfish from the family Astacidae and the 4(th) for northern hemisphere genera.
An experiment was conducted to determine the effect of different stocking densities on serum corticosterone (CORT), ovotransferrin (OVT), α1-acid glycoprotein (AGP) and ceruloplasmin (CP) concentrations, brain heat shock protein (HSP) 70 expression and performance in broiler chickens exposed to unheated and heated conditions. Day-old chicks were stocked at 0.100 m(2)/bird (low density (LD)) or 0.063 m(2)/bird (high density (HD)), in battery cages and housed in environmentally controlled rooms. From 21 to 35 days of age, birds from each stocking density group were exposed to either 24 or 32 °C. Growth performance was recorded during the heat treatment period, and blood and brain samples were collected to determine CORT, OVT, AGP, CP and HSP 70 levels on day 35. Heat treatment but not stocking density was detrimental to growth performance. There were significant temperature × density interactions for CORT, CP and OVT on day 35. Although HD elevated CORT, CP and OVT when compared to LD, the effects of the former were more obvious under heated condition. Both temperature and density had significant effect on AGP and HSP 70. In conclusion, irrespective of temperature, high stocking density was physiologically stressful to broiler chickens, as indicated by CORT, AGP, CP, OVT and HSP 70, but not detrimental to growth performance and survivability. As it was shown in the present study, AGP, CP and OVT could be useful biomarkers to determine the effect of overcrowding and high temperature on the welfare of broiler chickens.
The complete mitochondrial genome of the commercially and ecologically important and internationally vulnerable giant clam Tridacna squamosa was recovered by genome skimming using the MiSeq platform. The T. squamosa mitogenome has 20,930 base pairs (62.35% A+T content) and is made up of 12 protein-coding genes, 2 ribosomal subunit genes, 24 transfer RNAs, and a 2594 bp non-coding AT-rich region. The mitogenome has a relatively large insertion in the atp6 gene. This is the first mitogenome to be sequenced from the genus Tridacna, and the family Tridacnidae and represents a new gene order.
The pyrolysis of karanj fruit hulls (KFH) and karanj fruit hull hydrothermal carbonization (KFH-HTC) hydrochar was thermogravimetrically investigated under a nitrogen environment at 5 °C/min, 10 °C/min, and 20 °C/min. The pyrolysis decomposition of KFH biomass was faster than that of KFH-HTC hydrochar because of the high volatility and fixed carbon of KFH biomass. Weight loss percentage was also affected by the heating rates. The kinetic data were evaluated with the Kissinger-Akahira-Sunose and Flynn-Wall-Ozawa methods. The activation energy values obtained with these two methods were 61.06 and 68.53 kJ/mol for KFH biomass and 130.49 and 135.87 kJ/mol for KFH-HTC hydrochar, respectively. The analysis of kinetic process mechanisms was verified with the Coats-Redfern method. KFH-HTC hydrochar may play a potential role in transforming biomass to energy-rich feedstock for thermochemical applications because of its high heating value, high fixed carbon, and low ash and sulfur contents.
The amino acid compositions of bovine, porcine and fish gelatin were determined by amino acid analysis using 6-aminoquinolyl-N-hydroxysuccinimidyl carbamate as derivatization reagent. Sixteen amino acids were identified with similar spectral chromatograms. Data pre-treatment via centering and transformation of data by normalization were performed to provide data that are more suitable for analysis and easier to be interpreted. Principal component analysis (PCA) transformed the original data matrix into a number of principal components (PCs). Three principal components (PCs) described 96.5% of the total variance, and 2 PCs (91%) explained the highest variances. The PCA model demonstrated the relationships among amino acids in the correlation loadings plot to the group of gelatins in the scores plot. Fish gelatin was correlated to threonine, serine and methionine on the positive side of PC1; bovine gelatin was correlated to the non-polar side chains amino acids that were proline, hydroxyproline, leucine, isoleucine and valine on the negative side of PC1 and porcine gelatin was correlated to the polar side chains amino acids that were aspartate, glutamic acid, lysine and tyrosine on the negative side of PC2. Verification on the database using 12 samples from commercial products gelatin-based had confirmed the grouping patterns and the variables correlations. Therefore, this quantitative method is very useful as a screening method to determine gelatin from various sources.
Biodiesel with improved yield was produced from microalgae biomass under simultaneous cooling and microwave heating (SCMH). Nannochloropsis sp. and Tetraselmis sp. which were known to contain higher lipid species were used. The yield obtained using this novel technique was compared with the conventional heating (CH) and microwave heating (MWH) as the control method. The results revealed that the yields obtained using the novel SCMH were higher; Nannochloropsis sp. (83.33%) and Tetraselmis sp. (77.14%) than the control methods. Maximum yields were obtained using SCMH when the microwave was set at 50°C, 800W, 16h of reaction with simultaneous cooling at 15°C; and water content and lipid to methanol ratio in reaction mixture was kept to 0 and 1:12 respectively. GC analysis depicted that the biodiesel produced from this technique has lower carbon components (<19 C) and has both reasonable CN and IV reflecting good ignition and lubricating properties.
BACKGROUND: Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak.
METHODS: Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing.
RESULTS: Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients.
CONCLUSION: The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations.