MyMedR

Displaying publications 61 - 80 of 309 in total

Abstract:

Sort:

Distribution of HLA-A, -B and -DRB1 alleles in the Kensiu and Semai Orang Asli sub-groups in Peninsular Malaysia

Tasnim AR, Allia S, Edinur HA, Panneerchelvam S, Zafarina Z, Norazmi MN

Hum Immunol, 2016 Aug;77(8):618-619.
PMID: 27296326 DOI: 10.1016/j.humimm.2016.06.009

The earliest settlers in Peninsular Malaysia are the Orang Asli population, namely Semang, Senoi and Proto Malays. In the present study, we typed the HLA-A, -B and -DRB1 loci of the Kensiu and Semai Orang Asli sub-groups. Sequence-based HLA typing was performed on 59 individuals from two Orang Asli sub-groups. A total of 11, 18 and 14 HLA-A, -B and -DRB1 alleles were identified, respectively. These data are available in the Allele Frequencies Net Database under the population name "Malaysia Kedah Kensiu" and "Malaysia Pahang Semai".

Matched MeSH terms: Population Groups
Are speech-evoked auditory brainstem response (speech-ABR) outcomes influenced by ethnicity?

Zakaria MN, Jalaei B, Aw CL, Sidek D

Neurol Sci, 2016 Jun;37(6):943-8.
PMID: 26921173 DOI: 10.1007/s10072-016-2522-0

Due to its objective nature, auditory brainstem response (ABR) evoked by complex stimuli has been gaining attention lately. The present study aimed to compare the speech-evoked auditory brainstem response (speech-ABR) results between two ethnic groups: Malay and Chinese. In addition, it was also of interest to compare the speech-ABR outcomes obtained from the present study with the published Caucasian data. Thirty healthy male adults (15 Malay and 15 Chinese) were enrolled in this comparative study. Speech syllable/da/presented at 80 dBnHL was used to record speech-ABR waveforms from the right ear of each subject. Amplitudes and latencies of speech-ABR peaks (V, A, C, D, E, F and O), as well as composite onset measures (V/A duration, V/A amplitude and V/A slope) were computed and analyzed. When the two ethnic groups were compared, all speech-ABR results were not statistically different from each other (p > 0.05). When the data from the present study were compared with the published Caucasian data, most of the statistical analyses were significant (p

Matched MeSH terms: Continental Population Groups
Risk of Peritoneal Dialysis-Related Peritonitis in a Multi-Racial Asian Population

Ong LM, Ch'ng CC, Wee HC, Supramaniam P, Zainal H, Goh BL, et al.

Perit Dial Int, 2016 05 04;37(1):35-43.
PMID: 27147287 DOI: 10.3747/pdi.2015.00141

♦ BACKGROUND: Peritonitis is one of the most common complications of peritoneal dialysis (PD). Understanding the risk factors of peritonitis in a multi-racial Asian population may help to improve outcomes on PD. ♦ METHODS: We conducted a prospective observational study to identify risk factors for PD-related peritonitis over a 1-year period in 15 adult PD centers. All peritonitis episodes were independently adjudicated. ♦ RESULTS: A total of 1,603 participants with a mean age of 51.6 years comprising 52.7% females, 62.6% ethnic Malays, 27.0% Chinese, and 8.1% Indians were recruited. The overall peritonitis rate was 1 episode per 44.0 patient-months with 354 episodes recorded in 282 (17.6%) patients over 15,588 patient-months. Significant risk factors of peritonitis were severe obesity (incidence-rate ratio [IRR] 3.32, 95% confidence interval [CI]: 1.30, 8.45), hypoalbuminemia (IRR 1.61, 95% CI: 1.06, 2.46), Staphylococcus aureus nasal carriage (IRR 2.26, 95% CI: 1.46, 3.50), and use of Fresenius system (Fresenius Medical Care North America, Waltham, MA, USA) (IRR 2.49, 95% CI: 1.27, 4.89). The risk of peritonitis was lower in those on automated PD compared with standard PD (IRR 0.43, 95% CI: 0.25, 0.74), and in centers with a patient-staff ratio of 15 to 29.9 (IRR 0.67, 95% CI: 0.49, 0.90) and ≥ 30 (IRR 0.52, 95% CI: 0.34, 0.80). Prevalent patients and exit-site care with topical antibiotics were also protective against peritonitis. Peritonitis rates varied between racial groups. The IRRs of overall peritonitis and gram-positive peritonitis in Chinese versus other racial groups were 0.65 (95% CI: 0.46, 0.90) and 0.47 (95% CI: 0.24, 0.91), respectively. ♦ CONCLUSIONS: Multiple patient, center, and PD-system factors influence the risk of peritonitis. In the Asian population, there are racial differences in the risk of peritonitis.

Matched MeSH terms: Continental Population Groups
Translation and Validation of Bahasa Malaysia Version of Urogenital Distress Inventory (UDI-6) and Incontinence Impact Quality of Life Questionnaires (IIQ-7), a Cross Sectional Study

Nusee Z, Rusly A, Jamalludin AR, Abdulwahab DF, Ismail R

Malays J Med Sci, 2016 May;23(3):57-63.
PMID: 27418870

BACKGROUND: Urinary incontinence (UI) demonstrates major prevalence in women of different population groups. Reduced quality of life (QOL) is observed due to incontinence problems. Urogenital Distress Inventory (UDI-6) and Incontinence Impact Quality of Life (IIQ-7) are useful disease-specific questionnaires evaluating the impact of urinary incontinence on the QOL of women which is accepted internationally.
OBJECTIVE: This study aims to translate and validate UDI-6 and IIQ-7 in Malay language.
METHODS: A cross sectional study, which recruited 100 participants from two urogynecology clinics. Both questionnaires were initially translated from English to Bahasa Malaysia followed by back translation and final correction done by the professional translators. The participants were requested to maintain a urinary record of the upcoming week for three days that assisted in quantifying the severity of symptoms. None of the subjects were assigned any treatment during the study period. Validity and reliability of the translated questionnaires were determined by checking the internal consistency and also by doing test-retest.
RESULTS: The internal consistency levels of the UDI-6 and IIQ-7 Bahasa Malaysia questionnaires were 0.73 and 0.90 respectively with good test-retest (0.86 and 0.95). Incontinence episodes were strongly associated with obstructive, irritative, and stress symptoms. The factor of day time voiding had strong correlation with obstructive and irritative symptoms.
CONCLUSION: UDI-6 and IIQ-7 did not measure similar outcomes; however, both questionnaires have their strengths in clinical settings. Analysis has also revealed that the Malaysian versions of both questionnaires had appropriate test-retest validity and reliability. Thus, it can be said that both of the questionnaires had great importance for screening patients with urinary incontinence in Malaysia.

Matched MeSH terms: Population Groups
Distribution of cytokine gene polymorphisms in six Orang Asli subgroups in Peninsular Malaysia

Norhalifah HK, Syafawati WU, Che Mat NF, Chambers GK, Edinur HA

Hum Immunol, 2016 Apr;77(4):338-9.
PMID: 26820937 DOI: 10.1016/j.humimm.2016.01.015

Cytokines are involved in immune responses and the pathogenesis of various diseases. Allelic variations within the genes coding for various ∼30kDa cytokine protein/glycoproteins have been reported for many populations and have been the subjects of many ancestry and health analyses. In this study, we typed 22 single nucleotide polymorphisms (SNPs) in 13 cytokine genes of 165 Orang Asli individuals by using sequence specific primer-polymerase chain reaction (SSP-PCR) assay. The volunteers came from all across the Peninsular of Malaysia and belong to six Orang Asli subgroups; Batek, Kensiu, Lanoh, Che Wong, Semai and Orang Kanaq. Here we report our general findings and original genotype data and their associated analyses (Hardy-Weinberg proportions, estimation of allele and haplotype frequencies) can be found in the supplementary files and will be held at Allele Frequency Net Database (AFND).

Matched MeSH terms: Population Groups
Poverty within watershed and environmentally protected areas: the case of the indigenous community in Peninsular Malaysia

Kari FB, Masud MM, Yahaya SR, Saifullah MK

Environ Monit Assess, 2016 Mar;188(3):173.
PMID: 26887312 DOI: 10.1007/s10661-016-5162-1

"Indigenous people" have been acknowledged as among the poorest and most socio-economically and culturally marginalized all over the world. This paper explores the socio-economic status of the indigenous people and their poverty profile within watershed and environmentally protected areas in Peninsular Malaysia. The findings of the study indicate that the "indigenous community" is likely to be poor if they live in environmentally sensitive and unprotected areas as compared to families under the new resettlement scheme. Inadequate access to basic education and employment contributed significantly to their poor economic status. The findings further reveal that the indigenous community is facing difficulties in receiving access and support in terms of basic needs such as housing, education, economic livelihood, and other social infrastructure. Moreover, the regulatory structure for the management of watershed areas as well as the emphasis for commodity crops such as palm oil and natural rubber have indirectly contributed toward the poverty level of the indigenous people.

Matched MeSH terms: Population Groups*
Fulltext Stiff hands and feet, facial deformities

Thuraisingham C, Sinniah D

J Fam Pract, 2016 Feb;65(2):121-4.
PMID: 26977463

The appearance of the skin on this woman's face, hands, and feet helped us to recognize an advanced case of an autoimmune disease.

Matched MeSH terms: Continental Population Groups
Fulltext Barriers to health promotion for indigenous communities: lessons for Malaysia

Aniza, I, Norhayati, M

Malaysian Journal of Public Health Medicine, 2016;16(1):6-14.
MyJurnal

Globally, the health of the indigenous people is lagging behind as compared to the mainstream population in countries in which they live. Despite improved overall prosperity and population longevity, social and health inequalities seem to persist in this underprivileged community. Failure in delivering effective health promotion toward the indigenous community is determined by a range of factors. This includes the absence of culturally sensitive awareness among the healthcare workers, ineffective communication of the healthcare providers, poor access to health service, lack of culturally specific health promotional materials, lack of involvement by indigenous healthcare workers, lack of community based programs and inefficiency of indigenous health data collection. Effective interventions for indigenous health require a trans-disciplinary and holistic approach that incorporates indigenous health beliefs and engages with the social and cultural drivers of health.Such culturally congruent health promotion strategies are hoped to narrow down the existing wide gap of health outcomes that contribute to inequalities between indigenous communities and the mainstream population.

Matched MeSH terms: Population Groups
Experience of menopause in aboriginal women: a systematic review

Chadha N, Chadha V, Ross S, Sydora BC

Climacteric, 2016;19(1):17-26.
PMID: 26653073 DOI: 10.3109/13697137.2015.1119112

Every woman experiences the menopause transition period in a very individual way. Menopause symptoms and management are greatly influenced by socioeconomic status in addition to genetic background and medical history. Because of their very unique cultural heritage and often holistic view of health and well-being, menopause symptoms and management might differ greatly in aboriginals compared to non-aboriginals. Our aim was to investigate the extent and scope of the current literature in describing the menopause experience of aboriginal women. Our systematic literature review included nine health-related databases using the keywords 'menopause' and 'climacteric symptoms' in combination with various keywords describing aboriginal populations. Data were collected from selected articles and descriptive analysis was applied. Twenty-eight relevant articles were included in our analysis. These articles represent data from 12 countries and aboriginal groups from at least eight distinctive geographical regions. Knowledge of menopause and symptom experience vary greatly among study groups. The average age of menopause onset appears earlier in most aboriginal groups, often attributed to malnutrition and a harsher lifestyle. This literature review highlights a need for further research of the menopause transition period among aboriginal women to fully explore understanding and treatment of menopause symptoms and ultimately advance an important dialogue about women's health care.

Matched MeSH terms: Population Groups
Petiole Vascular Bundles and its Taxonomic Value in the Tribe Dipterocarpeae (Dipterocarpaceae)

Ruzi A, Ismail BS, Ummu Hani B, Sahimi S, Azi Azeyanty J, Noraini T

Sains Malaysiana, 2016;45:247-253.

A comprehensive survey and descriptions on the petiole anatomy was undertaken on 16 species belonging to four selected genera (Anisoptera, Cotylelobium, Vatica and Upuna) in the tribe Dipterocarpeae to investigate variations in vascular bundle structure. Methods used in this study were petiole sectioning using a sliding microtome, staining, mounting and observation under light microscope. Findings had shown that all species studied have complex vascular bundle structures, consisting of outer and medullary vascular bundles. Four different types of vascular bundle arrangements were found and described as Types 1, 2, 3 and 4. The vascular bundle types were determined based on the arrangement and system of vascular bundle strands present in the petiole transverse sections. These vascular bundle types were determined and suggested for easy reference. The results showed that vascular bundles can be used for identification of certain species and can definitely be used for classification of different genera. The presence of sclerenchyma cells is useful in differentiating genera. As a conclusion, the petiole vascular bundle anatomical characteristics have taxonomic value, especially in the identification of some species and possibly applicable in the classification of the tribe Dipterocarpeae.

Matched MeSH terms: Population Groups
High allele frequency of CYP2C9*3 (rs1057910) in a Negrito's subtribe population in Malaysia; Aboriginal people of Jahai

Rosdi RA, Mohd Yusoff N, Ismail R, Soo Choon T, Saleem M, Musa N, et al.

Ann Hum Biol, 2015 Sep 24.
PMID: 26402341

CYP2C9 gene polymorphisms modulate inter-individual variations in the human body's responses to various endogenous and exogenous drug substrates. To date, little is known about the CYP2C9 gene polymorphisms among the aboriginal populations of the world, including those in Malaysia.

Matched MeSH terms: Population Groups
Steroid-induced diabetes mellitus in systemic lupus erythematosus patients: analysis from a Malaysian multi-ethnic lupus cohort

Shaharir SS, Gafor AH, Said MS, Kong NC

Int J Rheum Dis, 2015 Jun;18(5):541-7.
PMID: 25294584 DOI: 10.1111/1756-185X.12474

OBJECTIVE:
Systemic lupus erythematosus (SLE) is a chronic autoimmune disease and glucocorticoid is the mainstay of treatment in SLE. The reported incidence of steroid-induced diabetes mellitus (SDM) ranged between 1-53%. We sought to investigate the prevalence and associated factors of SDM in patients with SLE.

METHODOLOGY:
A total of 100 SLE patients attending the Nephrology/SLE and Rheumatology Clinic, Universiti Kebangsaan Malaysia Medical Centre (UKMMC) who received corticosteroid treatment were recruited. The diagnosis of diabetes mellitus was based on the 2010 American Diabetes Association's criteria. Prevalent cases of SDM were also included. Statistical analysis was performed to determine the factors associated with SDM.

RESULTS:
Thirteen of them (13%) developed SDM, with the median onset of diagnosis from commencement of glucocorticoid treatment being 8 years (range 0.5-21 years). Although only seven Indians were recruited into the study, three of them (42.9%) had SDM compared to Malays (9.3%) and Chinese (12.8%) (P ≤ 0.05). Univariate and multivariate analysis showed that higher numbers of system or organ involvement in SLE, abdominal obesity, hypertriglyceridemia and daily prednisolone of ≥ 1 mg/kg/day were the important associated factors of SDM (P ≤ 0.05). Meanwhile, hydroxychloroquine (HCQ) use was associated with reduced SDM prevalence (P < 0.05).

CONCLUSION:
The prevalence of SDM among SLE patients was 13% and Indians were more prone to develop SDM compared to other races. Higher numbers of system involvement, abdominal obesity, hypertriglyceridemia and the use of oral prednisolone of ≥ 1 mg/kg/day were associated with SDM, while HCQ use potentially protects against SDM.

© 2014 Asia Pacific League of Associations for Rheumatology and Wiley Publishing Asia Pty Ltd.

KEYWORDS:
SLE drug treatment; clinical aspects; systemic lupus erythematous

Matched MeSH terms: Continental Population Groups
Differential positive selection of malaria resistance genes in three indigenous populations of Peninsular Malaysia

Liu X, Yunus Y, Lu D, Aghakhanian F, Saw WY, Deng L, et al.

Hum Genet, 2015 Apr;134(4):375-92.
PMID: 25634076 DOI: 10.1007/s00439-014-1525-2

The indigenous populations from Peninsular Malaysia, locally known as Orang Asli, continue to adopt an agro-subsistence nomadic lifestyle, residing primarily within natural jungle habitats. Leading a hunter-gatherer lifestyle in a tropical jungle environment, the Orang Asli are routinely exposed to malaria. Here we surveyed the genetic architecture of individuals from four Orang Asli tribes with high-density genotyping across more than 2.5 million polymorphisms. These tribes reside in different geographical locations in Peninsular Malaysia and belong to three main ethno-linguistic groups, where there is minimal interaction between the tribes. We first dissect the genetic diversity and admixture between the tribes and with neighboring urban populations. Later, by implementing five metrics, we investigated the genome-wide signatures for positive natural selection of these Orang Asli, respectively. Finally, we searched for evidence of genomic adaptation to the pressure of malaria infection. We observed that different evolutionary responses might have emerged in the different Orang Asli communities to mitigate malaria infection.

Matched MeSH terms: Population Groups/genetics*
Fulltext Fine-scale mapping of the 5q11.2 breast cancer locus reveals at least three independent risk variants regulating MAP3K1

Glubb DM, Maranian MJ, Michailidou K, Pooley KA, Meyer KB, Kar S, et al.

Am J Hum Genet, 2015 Jan 08;96(1):5-20.
PMID: 25529635 DOI: 10.1016/j.ajhg.2014.11.009

Genome-wide association studies (GWASs) have revealed SNP rs889312 on 5q11.2 to be associated with breast cancer risk in women of European ancestry. In an attempt to identify the biologically relevant variants, we analyzed 909 genetic variants across 5q11.2 in 103,991 breast cancer individuals and control individuals from 52 studies in the Breast Cancer Association Consortium. Multiple logistic regression analyses identified three independent risk signals: the strongest associations were with 15 correlated variants (iCHAV1), where the minor allele of the best candidate, rs62355902, associated with significantly increased risks of both estrogen-receptor-positive (ER(+): odds ratio [OR] = 1.24, 95% confidence interval [CI] = 1.21-1.27, ptrend = 5.7 × 10(-44)) and estrogen-receptor-negative (ER(-): OR = 1.10, 95% CI = 1.05-1.15, ptrend = 3.0 × 10(-4)) tumors. After adjustment for rs62355902, we found evidence of association of a further 173 variants (iCHAV2) containing three subsets with a range of effects (the strongest was rs113317823 [pcond = 1.61 × 10(-5)]) and five variants composing iCHAV3 (lead rs11949391; ER(+): OR = 0.90, 95% CI = 0.87-0.93, pcond = 1.4 × 10(-4)). Twenty-six percent of the prioritized candidate variants coincided with four putative regulatory elements that interact with the MAP3K1 promoter through chromatin looping and affect MAP3K1 promoter activity. Functional analysis indicated that the cancer risk alleles of four candidates (rs74345699 and rs62355900 [iCHAV1], rs16886397 [iCHAV2a], and rs17432750 [iCHAV3]) increased MAP3K1 transcriptional activity. Chromatin immunoprecipitation analysis revealed diminished GATA3 binding to the minor (cancer-protective) allele of rs17432750, indicating a mechanism for its action. We propose that the cancer risk alleles act to increase MAP3K1 expression in vivo and might promote breast cancer cell survival.

Matched MeSH terms: Continental Population Groups/genetics
A new species of clearwing moth (Lepidoptera: Sesiidae: Osminiini) from Peninsular Malaysia, exhibiting bee-like morphology and behaviour

Skowron MA, Munisamy B, Hamid SB, Węgrzyn G

Zootaxa, 2015;4032(4):426-34.
PMID: 26624378 DOI: 10.11646/zootaxa.4032.4.7

A new species of Sesiidae, tribe Osminiini from Peninsular Malaysia, Heterosphecia pahangensis Skowron, displaying numerous bee-mimicking features, is described. DNA barcodes showed significant differences with related taxa. However, the paucity of Sesiidae barcodes from Southeast Asia prevents meaningful taxonomic comparisons. The closest match out of published data on Sesiidae barcodes is Heterosphecia bantanakai, Arita & Gorbunov (2000a) from the tribe Osminiini, which has 9.98% sequence divergence from Heterosphecia pahangensis. Photographs of the moth in its natural habitat are shown. Behavioural aspects, such as mud-puddling and mode of flight, are described and presented in a video.

Matched MeSH terms: Population Groups
Transfusion-dependent thalassemia in Northern Sarawak: a molecular study to identify different genotypes in the multi-ethnic groups and the importance of genomic sequencing in unstudied populations

Tan JA, Chin SS, Ong GB, Mohamed Unni MN, Soosay AE, Gudum HR, et al.

Public Health Genomics, 2015;18(1):60-4.
PMID: 25412720 DOI: 10.1159/000368342

BACKGROUND: Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak.
METHODS: Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing.
RESULTS: Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients.
CONCLUSION: The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations.

Matched MeSH terms: Population Groups/ethnology; Population Groups/genetics
Fulltext Race/Ethnic Differences in the Associations of the Framingham Risk Factors with Carotid IMT and Cardiovascular Events

Gijsberts CM, Groenewegen KA, Hoefer IE, Eijkemans MJ, Asselbergs FW, Anderson TJ, et al.

PLoS One, 2015;10(7):e0132321.
PMID: 26134404 DOI: 10.1371/journal.pone.0132321

BACKGROUND: Clinical manifestations and outcomes of atherosclerotic disease differ between ethnic groups. In addition, the prevalence of risk factors is substantially different. Primary prevention programs are based on data derived from almost exclusively White people. We investigated how race/ethnic differences modify the associations of established risk factors with atherosclerosis and cardiovascular events.
METHODS: We used data from an ongoing individual participant meta-analysis involving 17 population-based cohorts worldwide. We selected 60,211 participants without cardiovascular disease at baseline with available data on ethnicity (White, Black, Asian or Hispanic). We generated a multivariable linear regression model containing risk factors and ethnicity predicting mean common carotid intima-media thickness (CIMT) and a multivariable Cox regression model predicting myocardial infarction or stroke. For each risk factor we assessed how the association with the preclinical and clinical measures of cardiovascular atherosclerotic disease was affected by ethnicity.
RESULTS: Ethnicity appeared to significantly modify the associations between risk factors and CIMT and cardiovascular events. The association between age and CIMT was weaker in Blacks and Hispanics. Systolic blood pressure associated more strongly with CIMT in Asians. HDL cholesterol and smoking associated less with CIMT in Blacks. Furthermore, the association of age and total cholesterol levels with the occurrence of cardiovascular events differed between Blacks and Whites.
CONCLUSION: The magnitude of associations between risk factors and the presence of atherosclerotic disease differs between race/ethnic groups. These subtle, yet significant differences provide insight in the etiology of cardiovascular disease among race/ethnic groups. These insights aid the race/ethnic-specific implementation of primary prevention.

Matched MeSH terms: Continental Population Groups*
Fulltext Practices of Dengue Fever Prevention and the Associated Factors among the Orang Asli in Peninsular Malaysia

Chandren JR, Wong LP, AbuBakar S

PLoS Negl Trop Dis, 2015;9(8):e0003954.
PMID: 26267905 DOI: 10.1371/journal.pntd.0003954

BACKGROUND: Dengue is prevalent among Malaysia's indigenous peoples, known as the Orang Asli, and it poses a serious health threat to them. The study aims to look at the socio-demographic factors, health beliefs, and knowledge about dengue and its association to dengue prevention practices among Orang Asli communities in Peninsular Malaysia.
METHODS: A cross-sectional survey was conducted in 16 randomly selected Orang Asli villages from eight states in Peninsular Malaysia from April 2012 until February 2013.
RESULTS: A total of 560 Orang Asli were interviewed and 505 completed the survey. Slightly above half of the participants (n = 280, 55.4%) had a total dengue prevention score of 51-100 (of a possible score of 0-100). Multivariate analysis findings showed dengue knowledge, perceived barriers to perform dengue prevention, fogging frequency, and perceived susceptibility to dengue fever as significant factors associated to dengue prevention practices. Participants with a lower dengue knowledge score (score 0-18) were less likely (OR = 0.63, 95%CI = 0.44-0.92 vs. score 19-36, P = 0.015) to practice dengue prevention. Participants with low perceived barriers to prevent dengue (score of 1-5) were more likely (OR = 2.06, 95%CI = 1.21-3.53, vs. score of 6-10, P = 0.008) to practice dengue prevention. Villages that were not fogged (OR = 0.49, 95%CI = 0.24-0.99, P = 0.045) or rarely fogged (OR = 0.40, 95%CI = 0.22-0.75, P = 0.004) had lower dengue prevention practices than villages that were fogged often. Participants with low perceived susceptibility of acquiring dengue (score of 1-5) were less likely (OR = 0.54, 95%CI = 0.33-0.89 vs. score of 6-10, P = 0.018) to practice dengue prevention measures.
CONCLUSION: Findings imply that educational and health programmes should focus on enhancing dengue knowledge and perceived susceptibility of acquiring dengue and reducing perceived barriers to performing dengue prevention practices among the Orang Asli. More outreach on mosquito control campaigns should be carried out especially in villages where mosquito fogging is frequent.

Matched MeSH terms: Population Groups
The discriminative ability of waist circumference, body mass index and waist-to-hip ratio in identifying metabolic syndrome: Variations by age, sex and race

Kee CC, Mohd Ghazali S, Lim KH, Subenthiran S, Teh CH, Lim KK, et al.

Diabetes Metab Syndr, 2015 Apr-Jun;9(2):74-8.
PMID: 25819369 DOI: 10.1016/j.dsx.2015.02.006

OBJECTIVES: Many studies have suggested that there is variation in the capabilities of BMI, WC and WHR in predicting cardiometabolic risk and that it might be confounded by gender, ethnicity and age group. The objective of this study is to examine the discriminative abilities of body mass index (BMI), waist circumference (WC) and waist-hip ratio (WHR) to predict two or more non-adipose components of the metabolic syndrome (high blood pressure, hypertriglyceridemia, low high density lipoprotein-cholesterol and high fasting plasma glucose) among the adult Malaysian population by gender, age group and ethnicity.
METHODS: Data from 2572 respondents (1044 men and 1528 women) aged 25-64 years who participated in the Non Communicable Disease Surveillance 2005/2006, a population-based cross sectional study, were analysed. Participants' socio-demographic details, anthropometric indices (BMI, WC and WHR), blood pressure, fasting lipid profile and fasting glucose level were assessed. Receiver operating characteristics curves analysis was used to evaluate the ability of each anthropometric index to discriminate MetS cases from non-MetS cases based on the area under the curve.
RESULTS: Overall, WC had better discriminative ability than WHR for women but did not perform significantly better than BMI in both sexes, whereas BMI was better than WHR in women only. Waist circumference was a better discriminator of MetS compared to WHR in Malay men and women. Waist circumference and BMI performed better than WHR in Chinese women, men aged 25-34 years and women aged 35-44 years.
CONCLUSIONS: The discriminative ability of BMI and WC is better than WHR for predicting two or more non-adipose components of MetS. Therefore, either BMI or WC measurements are recommended in screening for metabolic syndrome in routine clinical practice in the effort to combat cardiovascular disease and type II diabetes mellitus.
Copyright © 2015 Diabetes India. Published by Elsevier Ltd. All rights reserved.
KEYWORDS: Adult; Body mass index; Metabolic syndrome; Waist circumference; Waist–hip ratio
Study name: Malaysia Non-Communicable Disease Surveillance-1 (MyNCDS-1) survey

Matched MeSH terms: Continental Population Groups
Fulltext Risk assessment of acquiring listeriosis from consumption of chicken offal in Selangor, Malaysia

Kuan, C.H., Goh, S.G., Loo, Y.Y., Chang, W.S., Lye, Y.L., Puspanadan, S., et al.

International Food Research Journal, 2015;22(4):1711-1718.
MyJurnal

Listeria monocytogenes (L. monocytogenes) is an important foodborne pathogen which can cause foodborne listeriosis with high mortality rates especially in susceptible population groups such as pregnant women, elderly and immunocompromised individuals. The biosafety level of L. monocytogenes in chicken offal has becomes a great concern as chicken offal is a cheap source of protein and it is often served as side dishes in South East Asian countries. In Malaysia, the consumption of chicken offal has almost doubled from 5 g per capita per day in the early 1980s to 9 g per capita per day in 2009. In this study, risk assessment was conducted to estimate the risk of acquiring listeriosis from consumption of chicken offal in Malaysia. A microbial survey on the prevalence and concentration of L. monocytogenes in chicken offal were carried out in Selangor, Malaysia over a one-year period (November 2010 to October 2011). It was assumed that there were no seasonal changes in the prevalence and consumption pattern all year round. Assuming that 5.6 million people in Selangor, Malaysia consume a single serving (125 g) of chicken offal per week, it is estimated that in a year there could be 0.61 cases and 1.98 × 10-4 cases of listeriosis per 100,000 population of pregnant woman and immunocompromised individual, respectively. However, the potential for getting listeriosis among the healthy population was very low, only 1.39 × 10-8 cases per 100,000 population. This study demonstrated risk assessment model not only used as a tool to estimate the risk of acquiring illness but it can influence public health surveillance and providing data in setting appropriate level of protection.

Matched MeSH terms: Population Groups

Filters

Please provide feedback to Administrator (afdal@afpm.org.my)

External Links