Displaying publications 861 - 880 of 8208 in total

Abstract:
Sort:
  1. Pan JW, Zabidi MMA, Ng PS, Meng MY, Hasan SN, Sandey B, et al.
    Nat Commun, 2020 Dec 22;11(1):6433.
    PMID: 33353943 DOI: 10.1038/s41467-020-20173-5
    Molecular profiling of breast cancer has enabled the development of more robust molecular prognostic signatures and therapeutic options for breast cancer patients. However, non-Caucasian populations remain understudied. Here, we present the mutational, transcriptional, and copy number profiles of 560 Malaysian breast tumours and a comparative analysis of breast cancers arising in Asian and Caucasian women. Compared to breast tumours in Caucasian women, we show an increased prevalence of HER2-enriched molecular subtypes and higher prevalence of TP53 somatic mutations in ER+ Asian breast tumours. We also observe elevated immune scores in Asian breast tumours, suggesting potential clinical response to immune checkpoint inhibitors. Whilst HER2-subtype and enriched immune score are associated with improved survival, presence of TP53 somatic mutations is associated with poorer survival in ER+ tumours. Taken together, these population differences unveil opportunities to improve the understanding of this disease and lay the foundation for precision medicine in different populations.
    Matched MeSH terms: Breast Neoplasms/genetics*; Genetics, Population*; Mutation/genetics; Tumor Suppressor Protein p53/genetics; Receptor, ErbB-2/genetics; European Continental Ancestry Group/genetics; Asian Continental Ancestry Group/genetics*
  2. Yuan F, Hung RJ, Walsh N, Zhang H, Platz EA, Wheeler W, et al.
    Cancer Res, 2020 Sep 15;80(18):4004-4013.
    PMID: 32641412 DOI: 10.1158/0008-5472.CAN-20-0447
    Registry-based epidemiologic studies suggest associations between chronic inflammatory intestinal diseases and pancreatic ductal adenocarcinoma (PDAC). As genetic susceptibility contributes to a large proportion of chronic inflammatory intestinal diseases, we hypothesize that the genomic regions surrounding established genome-wide associated variants for these chronic inflammatory diseases are associated with PDAC. We examined the association between PDAC and genomic regions (±500 kb) surrounding established common susceptibility variants for ulcerative colitis, Crohn's disease, inflammatory bowel disease, celiac disease, chronic pancreatitis, and primary sclerosing cholangitis. We analyzed summary statistics from genome-wide association studies data for 8,384 cases and 11,955 controls of European descent from two large consortium studies using the summary data-based adaptive rank truncated product method to examine the overall association of combined genomic regions for each inflammatory disease group. Combined genomic susceptibility regions for ulcerative colitis, Crohn disease, inflammatory bowel disease, and chronic pancreatitis were associated with PDAC at P values < 0.05 (0.0040, 0.0057, 0.011, and 3.4 × 10-6, respectively). After excluding the 20 PDAC susceptibility regions (±500 kb) previously identified by GWAS, the genomic regions for ulcerative colitis, Crohn disease, and inflammatory bowel disease remained associated with PDAC (P = 0.0029, 0.0057, and 0.0098, respectively). Genomic regions for celiac disease (P = 0.22) and primary sclerosing cholangitis (P = 0.078) were not associated with PDAC. Our results support the hypothesis that genomic regions surrounding variants associated with inflammatory intestinal diseases, particularly, ulcerative colitis, Crohn disease, inflammatory bowel disease, and chronic pancreatitis are associated with PDAC. SIGNIFICANCE: The joint effects of common variants in genomic regions containing susceptibility loci for inflammatory bowel disease and chronic pancreatitis are associated with PDAC and may provide insights to understanding pancreatic cancer etiology.
    Matched MeSH terms: Celiac Disease/genetics; Colitis, Ulcerative/genetics; Crohn Disease/genetics; Pancreatic Neoplasms/genetics*; Cholangitis, Sclerosing/genetics; Inflammatory Bowel Diseases/genetics*; Carcinoma, Pancreatic Ductal/genetics*; Pancreatitis, Chronic/genetics
  3. Nadarajan VS, Ang CH, Bee PC
    Eur J Haematol, 2012 Feb;88(2):175-8.
    PMID: 21950422 DOI: 10.1111/j.1600-0609.2011.01712.x
    We investigated the role of lipocalin-2 (LCN-2) and its receptor (SLC22A17) in mediating clonal dominance in a patient with both BCR-ABL and JAK2-V617F mutations. LCN-2 mRNA showed a near 50-fold increase in expression, accompanied by down-regulation of SLC22A17, coinciding with increase in BCR-ABL transcripts, loss of JAK2-V617F and change of clinical phenotype from polycythaemia vera to chronic myeloid leukaemia. These changes were reversed after commencing imatinib mesylate. Consistent with experimental studies, BCR-ABL+ cells express LCN-2 leading to suppression of BCR-ABL- cells and explain their eventual dominance when occurring together with JAK2-V617F.
    Matched MeSH terms: Acute-Phase Proteins/genetics; Proto-Oncogene Proteins/genetics; RNA, Messenger/genetics; Leukemia, Myelogenous, Chronic, BCR-ABL Positive/genetics*; Fusion Proteins, bcr-abl/genetics*; Organic Cation Transport Proteins/genetics; Janus Kinase 2/genetics*; Lipocalins/genetics
  4. Au A, Griffiths LR, Cheng KK, Wee Kooi C, Irene L, Keat Wei L
    Sci Rep, 2015 Dec 15;5:18224.
    PMID: 26666837 DOI: 10.1038/srep18224
    Both OLR1 and PCSK9 genes are associated with atherosclerosis, cardiovascular disease and ischemic stroke. The overall prevalence of PCSK9 rs505151 and OLR1 rs11053646 variants in ischemic stroke were 0.005 and 0.116, respectively. However, to date, association between these polymorphisms and ischemic stroke remains inconclusive. Therefore, this first meta-analysis was carried out to clarify the presumed influence of these polymorphisms on ischemic stroke. All eligible case-control and cohort studies that met the search terms were retrieved in multiple databases. Demographic and genotyping data were extracted from each study, and the meta-analysis was performed using RevMan 5.3 and Metafor R 3.2.1. The pooled odd ratios (ORs) and 95% confidence intervals (CIs) were calculated using both fixed- and random-effect models. Seven case-control studies encompassing 1897 cases and 2119 controls were critically evaluated. Pooled results from the genetic models indicated that OLR1 rs11053646 dominant (OR = 1.33, 95%  CI:1.11-1.58) and co-dominant models (OR = 1.24, 95%  CI:1.02-1.51) were significantly associated with ischemic stroke. For the PCSK9 rs505151 polymorphism, the OR of co-dominant model (OR = 1.36, 95%  CI:1.01-1.58) was found to be higher among ischemic stroke patients. In conclusion, the current meta-analysis highlighted that variant allele of OLR1 rs11053646 G > C and PCSK9 rs505151 A > G may contribute to the susceptibility risk of ischemic stroke.
    Matched MeSH terms: Serine Endopeptidases/genetics*; Stroke/genetics*; Proprotein Convertases/genetics*; Scavenger Receptors, Class E/genetics*
  5. Tan JA, Chin SS, Ong GB, Mohamed Unni MN, Soosay AE, Gudum HR, et al.
    Public Health Genomics, 2015;18(1):60-4.
    PMID: 25412720 DOI: 10.1159/000368342
    BACKGROUND: Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak.
    METHODS: Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing.
    RESULTS: Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients.
    CONCLUSION: The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations.
    Matched MeSH terms: Ethnic Groups/genetics; Hemoglobinopathies/genetics; Population Groups/genetics; beta-Globins/genetics*
  6. Miah G, Rafii MY, Ismail MR, Puteh AB, Rahim HA, Latif MA
    C. R. Biol., 2015 Feb;338(2):83-94.
    PMID: 25553855 DOI: 10.1016/j.crvi.2014.11.003
    Backcross breeding is the most commonly used method for incorporating a blast resistance gene into a rice cultivar. Linkage between the resistance gene and undesirable units can persist for many generations of backcrossing. Marker-assisted backcrossing (MABC) along with marker-assisted selection (MAS) contributes immensely to overcome the main limitation of the conventional breeding and accelerates recurrent parent genome (RPG) recovery. The MABC approach was employed to incorporate (a) blast resistance gene(s) from the donor parent Pongsu Seribu 1, the blast-resistant local variety in Malaysia, into the genetic background of MR219, a popular high-yielding rice variety that is blast susceptible, to develop a blast-resistant MR219 improved variety. In this perspective, the recurrent parent genome recovery was analyzed in early generations of backcrossing using simple sequence repeat (SSR) markers. Out of 375 SSR markers, 70 markers were found polymorphic between the parents, and these markers were used to evaluate the plants in subsequent generations. Background analysis revealed that the extent of RPG recovery ranged from 75.40% to 91.3% and from 80.40% to 96.70% in BC1F1 and BC2F1 generations, respectively. In this study, the recurrent parent genome content in the selected BC2F2 lines ranged from 92.7% to 97.7%. The average proportion of the recurrent parent in the selected improved line was 95.98%. MAS allowed identification of the plants that are more similar to the recurrent parent for the loci evaluated in backcross generations. The application of MAS with the MABC breeding program accelerated the recovery of the RP genome, reducing the number of generations and the time for incorporating resistance against rice blast.
    Matched MeSH terms: Plant Diseases/genetics; Oryza/genetics*; Chromosomes, Plant/genetics; Disease Resistance/genetics
  7. Ngu MS, Thomson MJ, Bhuiyan MA, Ho C, Wickneswari R
    Genet. Mol. Res., 2014;13(4):9477-88.
    PMID: 25501158 DOI: 10.4238/2014.November.11.13
    Grain weight is a major component of rice grain yield and is controlled by quantitative trait loci. Previously, a rice grain weight quantitative trait locus (qGW6) was detected near marker RM587 on chromosome 6 in a backcross population (BC2F2) derived from a cross between Oryza rufipogon IRGC105491 and O. sativa cv. MR219. Using a BC2F5 population, qGW6 was validated and mapped to a region of 4.8 cM (1.2 Mb) in the interval between RM508 and RM588. Fine mapping using a series of BC4F3 near isogenic lines further narrowed the interval containing qGW6 to 88 kb between markers RM19268 and RM19271.1. According to the Duncan multiple range test, 8 BC4F4 near isogenic lines had significantly higher 100-grain weight (4.8 to 7.5% over MR219) than their recurrent parent, MR219 (P < 0.05). According to the rice genome automated annotation database, there are 20 predicted genes in the 88-kb target region, and 9 of them have known functions. Among the genes with known functions in the target region, in silico gene expression analysis showed that 9 were differentially expressed during the seed development stage(s) from gene expression series GSE6893; however, only 3 of them have known functions. These candidates provide targets for further characterization of qGW6, which will assist in understanding the genetic control of grain weight in rice.
    Matched MeSH terms: Organ Size/genetics; Oryza/genetics*; Seeds/genetics*; Quantitative Trait Loci/genetics*
  8. Masood Y, Kqueen CY, Rajadurai P
    Expert Rev Anticancer Ther, 2015 Feb;15(2):183-97.
    PMID: 25367254 DOI: 10.1586/14737140.2015.978294
    Head and neck squamous cell carcinoma (HNSCC) is the sixth most common malignancy worldwide. Evidence suggests that miRNAs play an important role in progression, recurrence, metastasis and postoperative survival of HNSCC. Studies have investigated the utility of miRNAs as diagnostic/prognostic tools and as potential therapeutic targets and biomarkers that may improve the management and outcomes of HNSCC. The aim of this article is to review the current literature on aberrant expression profiles of miRNAs in biopsy samples of HNSCC and their role in cancer development, metastasis, prognosis and survival of these patients. This review gives an overview that miRNAs deregulation play major role in the development of HNSCC. They offer the potential to be used as biomarkers or novel therapeutic targets. Future research is required to test their use in both of these fields.
    Matched MeSH terms: Carcinoma, Squamous Cell/genetics*; Head and Neck Neoplasms/genetics*; Biomarkers, Tumor/genetics; MicroRNAs/genetics*
  9. Vahtera V, Edgecombe GD
    PLoS One, 2014;9(11):e112461.
    PMID: 25389773 DOI: 10.1371/journal.pone.0112461
    Edentistoma octosulcatum Tömösváry, 1882, is a rare, superficially millipede-like centipede known only from Borneo and the Philippines. It is unique within the order Scolopendromorpha for its slow gait, robust tergites, and highly modified gizzard and mandible morphology. Not much is known about the biology of the species but it has been speculated to be arboreal with a possibly vegetarian diet. Until now its phylogenetic position within the subfamily Otostigminae has been based only on morphological characters, being variably ranked as a monotypic tribe (Arrhabdotini) or classified with the Southeast Asian genus Sterropristes Attems, 1934. The first molecular data for E. octosulcatum sourced from a newly collected specimen from Sarawak were analysed with and without morphology. Parsimony analysis of 122 morphological characters together with two nuclear and two mitochondrial loci resolves Edentistoma as sister group to three Indo-Australian species of Rhysida, this clade in turn grouping with Ethmostigmus, whereas maximum likelihood and parsimony analyses of the molecular data on their own ally Edentistoma with species of Otostigmus. A position of Edentistoma within Otostigmini (rather than being its sister group as predicted by the Arrhabdotini hypothesis) is consistently retrieved under different analytical conditions, but support values within the subfamily remain low for most nodes. The species exhibits strong pushing behaviour, suggestive of burrowing habits. Evidence against a suggested vegetarian diet is provided by observation of E. octosulcatum feeding on millipedes in the genus Trachelomegalus.
    Matched MeSH terms: Arthropods/genetics; Cell Nucleus/genetics; DNA, Mitochondrial/genetics*; Mitochondria/genetics
  10. Chan XY, Chua KO, How KY, Yin WF, Chan KG
    ScientificWorldJournal, 2014;2014:930727.
    PMID: 25436236 DOI: 10.1155/2014/930727
    Most Pseudomonas putida strains are environmental microorganisms exhibiting a wide range of metabolic capability but certain strains have been reported as rare opportunistic pathogens and some emerged as multidrug resistant P. putida. This study aimed to assess the drug resistance profile of, via whole genome analysis, P. putida strain T2-2 isolated from oral cavity. At the same time, we also compared the nonenvironmental strain with environmentally isolated P. putida. In silico comparative genome analysis with available reference strains of P. putida shows that T2-2 has lesser gene counts on carbohydrate and aromatic compounds metabolisms, which suggested its little versatility. The detection of its edd gene also suggested T2-2's catabolism of glucose via ED pathway instead of EMP pathway. On the other hand, its drug resistance profile was observed via in silico gene prediction and most of the genes found were in agreement with drug-susceptibility testing in laboratory by automated VITEK 2. In addition, the finding of putative genes of multidrug resistance efflux pump and ATP-binding cassette transporters in this strain suggests a multidrug resistant phenotype. In summary, it is believed that multiple metabolic characteristics and drug resistance in P. putida strain T2-2 helped in its survival in human oral cavity.
    Matched MeSH terms: Adaptation, Physiological/genetics*; Genome, Bacterial/genetics*; Pseudomonas putida/genetics*; Drug Resistance, Multiple, Bacterial/genetics*
  11. Zain SM, Mohamed Z, Mohamed R
    J Gastroenterol Hepatol, 2015 Jan;30(1):21-7.
    PMID: 25167786 DOI: 10.1111/jgh.12714
    BACKGROUND AND AIM: Although studies have suggested that rs780094, a common variant in the glucokinase regulatory (GCKR) gene to be associated with type 2 diabetes, obesity, and their related traits, the genetic basis of the association between GCKR rs780094 and nonalcoholic fatty liver disease (NAFLD) is still being examined. This meta-analysis was performed to evaluate the effect strength caused by GCKR rs780094 on NAFLD.
    METHODS: We searched Medline, PubMed, Scopus, and Embase for relevant articles published up to April 2014. Data were extracted, and summary estimates of the association between GCKR rs780094 and NAFLD were examined. Heterogeneity and publication bias were also examined.
    RESULTS: This meta-analysis incorporated a total of 2091 NAFLD cases and 3003 controls from five studies. Overall, the pooled result indicated that the GCKR rs780094 was significantly associated with increased risk of NAFLD (additive: odds ratio (OR) 1.25, 95% confidence interval (CI) 1.14-1.36, P 
    Matched MeSH terms: Genetic Predisposition to Disease/genetics*; Asian Continental Ancestry Group/genetics; Adaptor Proteins, Signal Transducing/genetics*; Non-alcoholic Fatty Liver Disease/genetics*
  12. Tan PW, Tan WS, Yunos NY, Mohamad NI, Adrian TG, Yin WF, et al.
    Sensors (Basel), 2014;14(7):12958-67.
    PMID: 25046018 DOI: 10.3390/s140712958
    Quorum sensing (QS), acts as one of the gene regulatory systems that allow bacteria to regulate their physiological activities by sensing the population density with synchronization of the signaling molecules that they produce. Here, we report a marine isolate, namely strain T47, and its unique AHL profile. Strain T47 was identified using 16S rRNA sequence analysis confirming that it is a member of Vibrio closely clustered to Vibrio sinaloensis. The isolated V. sinaloensis strain T47 was confirmed to produce N-butanoyl-L-homoserine lactone (C4-HSL) by using high resolution liquid chromatography tandem mass spectrometry. V. sinaloensis strain T47 also formed biofilms and its biofilm formation could be affected by anti-QS compound (cathechin) suggesting this is a QS-regulated trait in V. sinaloensis strain T47. To our knowledge, this is the first documentation of AHL and biofilm production in V. sinaloensis strain T47.
    Matched MeSH terms: RNA, Ribosomal, 16S/genetics; Vibrio/genetics; 4-Butyrolactone/genetics; Quorum Sensing/genetics
  13. Yap HY, Chooi YH, Firdaus-Raih M, Fung SY, Ng ST, Tan CS, et al.
    BMC Genomics, 2014;15:635.
    PMID: 25073817 DOI: 10.1186/1471-2164-15-635
    The sclerotium of Lignosus rhinocerotis (Cooke) Ryvarden or Tiger milk mushroom (Polyporales, Basidiomycota) is a valuable folk medicine for indigenous peoples in Southeast Asia. Despite the increasing interest in this ethnobotanical mushroom, very little is known about the molecular and genetic basis of its medicinal and nutraceutical properties.
    Matched MeSH terms: Fungal Proteins/genetics; Genes, Fungal/genetics; Polysaccharides/genetics; Polyporales/genetics*
  14. Osahor AN, Tan CY, Sim EU, Lee CW, Narayanan K
    Anal Biochem, 2014 Oct 1;462:26-8.
    PMID: 24929088 DOI: 10.1016/j.ab.2014.05.030
    When recombineering bacterial artificial chromosomes (BACs), it is common practice to design the ends of the donor molecule with 50 bp of homology specifying its insertion site. We demonstrate that desired recombinants can be produced using intermolecular homologies as short as 15 bp. Although the use of shorter donor end regions decreases total recombinants by several fold, the frequency of recombinants with correctly inserted donor molecules was high enough for easy detection by simple polymerase chain reaction (PCR) screening. This observation may have important implications for the design of oligonucleotides for recombineering, including significant cost savings, especially for high-throughput projects that use large quantities of primers.
    Matched MeSH terms: Escherichia coli/genetics; Plasmids/genetics; Telomere/genetics; Chromosomes, Artificial, Bacterial/genetics*
  15. Abdul-Latiff MA, Ruslin F, Faiq H, Hairul MS, Rovie-Ryan JJ, Abdul-Patah P, et al.
    Biomed Res Int, 2014;2014:897682.
    PMID: 25143948 DOI: 10.1155/2014/897682
    The phylogenetic relationships of long-tailed macaque (Macaca fascicularis fascicularis) populations distributed in Peninsular Malaysia in relation to other regions remain unknown. The aim of this study was to reveal the phylogeography and population genetics of Peninsular Malaysia's M. f. fascicularis based on the D-loop region of mitochondrial DNA. Sixty-five haplotypes were detected in all populations, with only Vietnam and Cambodia sharing four haplotypes. The minimum-spanning network projected a distant relationship between Peninsular Malaysian and insular populations. Genetic differentiation (F(ST), Nst) results suggested that the gene flow among Peninsular Malaysian and the other populations is very low. Phylogenetic tree reconstructions indicated a monophyletic clade of Malaysia's population with continental populations (NJ = 97%, MP = 76%, and Bayesian = 1.00 posterior probabilities). The results demonstrate that Peninsular Malaysia's M. f. fascicularis belonged to Indochinese populations as opposed to the previously claimed Sundaic populations. M. f. fascicularis groups are estimated to have colonized Peninsular Malaysia ~0.47 million years ago (MYA) directly from Indochina through seaways, by means of natural sea rafting, or through terrestrial radiation during continental shelf emersion. Here, the Isthmus of Kra played a central part as biogeographical barriers that then separated it from the remaining continental populations.
    Matched MeSH terms: DNA, Mitochondrial/genetics; Haplotypes/genetics; Macaca fascicularis/genetics*; Base Pairing/genetics
  16. Lau TP, Roslani AC, Lian LH, Chai HC, Lee PC, Hilmi I, et al.
    BMJ Open, 2014;4(8):e004930.
    PMID: 25107436 DOI: 10.1136/bmjopen-2014-004930
    To characterise the mRNA expression patterns of early and advanced stage colorectal adenocarcinomas of Malaysian patients.
    Matched MeSH terms: Adenocarcinoma/genetics*; RNA, Messenger/genetics*; Colorectal Neoplasms/genetics*; Gene Expression/genetics*
  17. Sekeli R, Abdullah JO, Namasivayam P, Muda P, Abu Bakar UK, Yeong WC, et al.
    Molecules, 2014 Jun 19;19(6):8350-62.
    PMID: 24950439 DOI: 10.3390/molecules19068350
    The purpose of this study was to evaluate the effectiveness of using RNA interference in down regulating the expression of 1-aminocyclopropane-1-carboxylic acid oxidase gene in Eksotika papaya. One-month old embryogenic calli were separately transformed with Agrobacterium strain LBA 4404 harbouring the three different RNAi pOpOff2 constructs bearing the 1-aminocyclopropane-1-carboxylic acid oxidase gene. A total of 176 putative transformed lines were produced from 15,000 calli transformed, selected, then regenerated on medium supplemented with kanamycin. Integration and expression of the targeted gene in putatively transformed lines were verified by PCR and real-time RT-PCR. Confined field evaluation of a total of 31 putative transgenic lines planted showed a knockdown expression of the targeted ACO1 and ACO2 genes in 13 lines, which required more than 8 days to achieve the full yellow colour (Index 6). Fruits harvested from lines pRNAiACO2 L2-9 and pRNAiACO1 L2 exhibited about 20 and 14 days extended post-harvest shelf life to reach Index 6, respectively. The total soluble solids contents of the fruits ranged from 11 to 14° Brix, a range similar to fruits from non-transformed, wild type seed-derived plants.
    Matched MeSH terms: Amino Acid Oxidoreductases/genetics; Fruit/genetics; Carica/genetics; Plants, Genetically Modified/genetics
  18. Fan SH, Say YH
    J Physiol Anthropol, 2014;33:15.
    PMID: 24947733 DOI: 10.1186/1880-6805-33-15
    BACKGROUND: This study was to investigate the prevalence of single nucleotide polymorphisms (SNPs) in leptin gene LEP (A19G and G2548A) and leptin receptor gene LEPR (K109R and Q223R) and their association with fasting plasma leptin level (PLL) and obesity in a Malaysian suburban population in Kampar, Perak.
    METHODS: Convenience sampling was performed with informed consents, and the study sample was drawn from patients who were patrons of the Kampar Health Clinic. A total of 408 subjects (mean age, 52.4 +/- 13.7 years; 169 men, 239 women; 190 obese, 218 non-obese; 148 Malays, 177 ethnic Chinese, 83 ethnic Indians) participated. Socio-demographic data and anthropometric measurements were taken, and genotyping was performed using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP).
    RESULTS: The LEP A19G, G2548A and LEPR K109R, Q223R variant allele frequencies were 0.74, 0.67 and 0.61, 0.79, respectively. The genotype and allele distributions of these gene variants were significantly different among ethnic groups, but not among body mass index (BMI) classes. Subjects with LEPR K109 and Q223 allele had significantly higher systolic blood pressure and adiposity indices after adjustment for ethnicity (higher BMI, total body and subcutaneous fat; lower skeletal muscle percentage). Subjects with LEPR 109R allele had lower PLL than their wild-type allele counterparts. The influence of LEP A19G and G2548A SNPs on blood pressures, anthropometrics, and PLL was not evident. Interestingly, synergistic effect of the LEP and LEPR SNPs was observed as subjects homozygous for all four SNPs studied exhibited significantly higher subcutaneous fat and PLL than those with other genotype combinations.
    CONCLUSIONS: The LEP and LEPR SNPs in this study may not be an obesity marker among Malaysians in this population, but were associated with ethnicity. Our findings suggest that each of these SNPs contributes to minor but significant variation in obesity-related traits and in combination they display synergistic effects on subcutaneous fat and PLL.
    Matched MeSH terms: Obesity/genetics*; Polymorphism, Single Nucleotide/genetics*; Leptin/genetics*; Receptors, Leptin/genetics*
  19. Low VL, Tan TK, Lim PE, Domingues LN, Tay ST, Lim YA, et al.
    Vet Parasitol, 2014 Aug 29;204(3-4):439-42.
    PMID: 24912955 DOI: 10.1016/j.vetpar.2014.05.036
    A multilocus sequence analysis using mitochondria-encoded cytochrome c oxidase subunit I (COI), cytochrome B (CytB), NADH dehydrogenase subunit 5 (ND5); nuclear encoded 18S ribosomal RNA (18S) and 28S ribosomal RNA (28S) genes was performed to determine the levels of genetic variation between the closely related species Haematobia irritans Linnaeus and Haematobia exigua de Meijere. Among these five genes, ND5 and CytB genes were found to be more variable and informative in resolving the interspecific relationships of both species. In contrast, the COI gene was more valuable in inferring the intraspecific relationships. The ribosomal 18S and 28S sequences of H. irritans and H. exigua were highly conserved with limited intra- and inter-specific variation. Molecular evidence presented in this study demonstrated that both flies are genetically distinct and could be differentiated based on sequence analysis of mitochondrial genes.
    Matched MeSH terms: Electron Transport Complex IV/genetics; Muscidae/genetics; NADH Dehydrogenase/genetics; Cytochromes b/genetics
  20. Zain SM, Mohamed R, Cooper DN, Razali R, Rampal S, Mahadeva S, et al.
    PLoS One, 2014;9(4):e95604.
    PMID: 24743702 DOI: 10.1371/journal.pone.0095604
    Between 10 and 25% of individuals with non-alcoholic fatty liver disease (NAFLD) develop hepatic fibrosis leading to cirrhosis and hepatocellular carcinoma (HCC). To investigate the molecular basis of disease progression, we performed a genome-wide analysis of copy number variation (CNV) in a total of 49 patients with NAFLD [10 simple steatosis and 39 non-alcoholic steatohepatitis (NASH)] and 49 matched controls using high-density comparative genomic hybridization (CGH) microarrays. A total of 11 CNVs were found to be unique to individuals with simple steatosis, whilst 22 were common between simple steatosis and NASH, and 224 were unique to NASH. We postulated that these CNVs could be involved in the pathogenesis of NAFLD progression. After stringent filtering, we identified four rare and/or novel CNVs that may influence the pathogenesis of NASH. Two of these CNVs, located at 13q12.11 and 12q13.2 respectively, harbour the exportin 4 (XPO4) and phosphodiesterase 1B (PDE1B) genes which are already known to be involved in the etiology of liver cirrhosis and HCC. Cross-comparison of the genes located at these four CNV loci with genes already known to be associated with NAFLD yielded a set of genes associated with shared biological processes including cell death, the key process involved in 'second hit' hepatic injury. To our knowledge, this pilot study is the first to provide CNV information of potential relevance to the NAFLD spectrum. These data could prove invaluable in predicting patients at risk of developing NAFLD and more importantly, those who will subsequently progress to NASH.
    Matched MeSH terms: Karyopherins/genetics; Cyclic Nucleotide Phosphodiesterases, Type 1/genetics; DNA Copy Number Variations/genetics*; Non-alcoholic Fatty Liver Disease/genetics*
Filters
Contact Us

Please provide feedback to Administrator (afdal@afpm.org.my)

External Links