Displaying publications 81 - 100 of 159 in total

Abstract:
Sort:
  1. Mislia Othman, Muhammad Azrul Zabidi
    MyJurnal
    This review paper aims to present an overview of the development of blood substitute particularly red blood cell substitute or artificial oxygen carrier. Knowledge on human blood inspired from the understanding of human blood circulation system. Ibn Nafis was first to describe that blood flow through respiratory system before entering the heart. This finding denied the claim that tiny pores present within the septum of the heart. Then, William Harvey further described human cardiovascular system in detail and contributed to better understanding on the roles of blood in body. Several blood transfusions were attempted using blood collected from human, animal and other blood substitutes such as milk before the practice was banned for almost 150 years in Europe. Major discoveries on blood group and antibody reaction have made blood transfusion safer. However, several issues and challenges have re-triggered the exploration to develop red cell substitutes. Two approaches have been taken to develop the red blood cell substitute which are classified into biological and chemical based oxygen carriers. The earliest efforts have been on haemoglobin based oxygen carrier (HBOC) and perfluorocarbon (PFC) while the recent developement are on polymer-based oxygen carrier and in-vitro stem cell derived red blood cell.
    Matched MeSH terms: Blood Transfusion
  2. Salina H., Lim P.S., Gendeh B.S.
    MyJurnal
    Hereditary Hemorrhagic Telangiectasia, also known as Osler-Weber-Rendu Syndrome is an autosomal
    dominant disorder causing systemic abnormalities of the vascular structure. There are multiple arteriovenous malformations present in the skin and mucosal surface of the nail beds, nose, gastrointestinal tract, lungs and brain. Epistaxis is the common presentation symptom, which may require multiple hospital admissions and blood transfusions. It is extremely rare disease in our population. We report 4 cases of HHT who presented to us with moderate to severe epistaxis and how we managed these patients.
    Matched MeSH terms: Blood Transfusion
  3. Chiu CK, Tan RL, Gani SMA, Chong JSL, Chung WH, Chan CYW, et al.
    Asian Spine J, 2021 May 07.
    PMID: 33957021 DOI: 10.31616/asj.2020.0649
    Study Design: Retrospective study.

    Purpose: To report the perioperative and radiological outcomes of single-stage posterior passive correction and fusion (SSPPCF) in adolescent patients who present with congenital scoliosis.

    Overview of Literature: The surgical treatment for congenital scoliosis is complex. There is no definitive guide on surgical options for skeletally matured adolescent patients who have congenital scoliosis.

    Methods: Patients with congenital scoliosis who underwent SSPPCF using a pedicle screw system were reviewed. We identified the following three surgical indications: (1) hemivertebra or wedge vertebra over the thoracic or thoracolumbar region with structural lumbar curves, (2) hemivertebra or wedge vertebra at the lumbar region with significant pelvic obliquity or sacral slanting, and (3) mixed or complex congenital scoliosis. The demographic, perioperative, and radiographic data of these patients were collected.

    Results: Thirty-four patients were reviewed. The mean patient age was 14.6±3.4 years. There were 13 hemivertebrae, three wedged vertebrae, two butterfly vertebrae, three hemivertebrae with butterfly vertebra, eight unsegmented bars, and five multiple complex lesions. The average surgical duration was 219.4±68.8 minutes. The average blood loss was 1,208.4±763.5 mL. Seven patients required allogeneic blood transfusion. The mean hospital stay duration was 6.1±2.5 days. The complication rate was 11.8% (4/34): one patient had severe blood loss, one had rod breakage, and two had distal adding-on. The Cobb angle reduced from 65.9°±17.4° to 36.3°±15.3° (p<0.001) with a correction rate (CR) of 44.8%±17.4%. The regional kyphotic angle decreased from 39.9°±20.5° to 27.5°±13.9° (p=0.001) with a CR of 19.3%±49.6%. Radiographic parameters (radiographic shoulder height, clavicle angle, T1 tilt, cervical axis, pelvic obliquity, coronal balance, and apical vertebral translation) showed significant improvement postoperatively.

    Conclusions: SSPPCF was a feasible option for adolescent patients with congenital scoliosis who were skeletally matured.

    Matched MeSH terms: Blood Transfusion
  4. Lai Kuan Teh, Li Fang Lim, Yu Leong Teh, Tze Yan Lee, Lay Ngor Lim, Elizabeth George
    MyJurnal
    Introduction: Reduction or complete absence of α-globin chain production may result α-thalassemia. Alpha thalassemia carrier may have normal haemoglobin level and thus will be eligible as blood donor. Few complications may happen in which the carrier who donated the blood might be at risk of hypoxia and their blood components might not suitable for transfusion. Thus, it is important to screen for α-thalassemia to prevent any complications happen
    after donation. The objective of this study is to investigate the interaction of red blood cell indices and α-globin genotypes among eligible blood donors in a private university, Universiti Tunku Abdul Rahman (UTAR), Malaysia. Methods: A total of 270 eligible blood donors were recruited for this study. Red cell indices were analysed using Horiba hematology analyser and α-globin genotyping was performed for seven alpha deletions, six alpha point mutations
    and two alpha triplications. Results: Our study showed high prevalence of α-thalassemia carriers among the eligible blood donors (7.7%, 21/270), with all of them showed normal Hb level (>12 gm/dl). Five genotypes were detected consisting of 249 αα/αα (92.2%), 9 -α3.7/αα (3.3%), 9 --SEA/αα (3.3%), 2 -α4.2/αα (0.7%) and 1 ααCS/αα (0.4%). All α-globin genotypes showed normal Hb level with no significant difference between genotypes (p=0.167). Different
    α-globin genotypes showed significant difference in RBC, MCV, MCH, MCHC, RDW and Hct/Hb ratio at the p
    Matched MeSH terms: Blood Transfusion
  5. Tan PP, Mohamed Fauzi, H., Chang CT, Ahmad NH, Bahar B, Mangantig E, et al.
    MyJurnal
    ABSTRACTS FOR INTERNATIONAL HEALTH AND MEDICAL SCIENCES CONFERENCE 2019 (IHMSC 2019)
    Held at Taylor’s University Lakeside Campus, Subang Jaya, Selangor, Malaysia, 8-9th March, 2019
    Introduction: Unsafe blood products cause transfusion-transmissible infections among blood receivers. The knowledge and perception of blood donors is important as it is associated with their donation behaviour and hence the safety of blood products. There was no previous study that assessed the knowledge and perception on blood safety issues among blood donors to date. The objective of this study was to assess the knowledge and perception of blood
    donors on blood safety issues.
    Methods: This was a pilot study conducted to pilot test the self-developed questionnaire by the researchers. The questionnaire was available in the Malay language. One-hundred-thirty donors at the National Blood Centre were recruited to complete the self-administered questionnaire. Health sciences professionals, medical students and non-Malaysians were excluded in this study.
    Results: A total of 130 donors comprising of 70 males (53.8%) and 60 females (46.2%) responded. The mean age of the respondents is 32.48±8.86 years. Most of the respondents were Malay (55.4%), single (49.2%), working in private sector (46.9%) and regular donor (68.5%). More than half of the respondents did not know that dengue, Zika and mad-cow disease can be contracted through blood transfusion. Ten percent of the respondents answered that bisexual people are eligible to donate blood. 40.7% of the donors agreed to check their HIV status through blood donation. Majority of the donors (60.7%) agreed that the donors’ blood is safe if the screening test is negative. Whereas, 33.9% of the donors disagreed that they shall be responsible if their blood causes infection.
    Conclusion: Several knowledge gaps and inappropriate perception among the respondents were identified and these might affect the safety of the blood products. Targeted measures should be taken to rectify donors’ knowledge and perception in order to minimise inappropriate blood donor behaviours and reduce unsafe blood products.
    Matched MeSH terms: Blood Transfusion
  6. Suria, A.A., Nurdiayana, M.N., Huik, May L., Alex, Y.C.S, Noornabillah, R., Hud, M.A., et al.
    Medicine & Health, 2012;7(1):41-46.
    MyJurnal
    Red cell alloimmunisation is defined as the development of antibodies in response to foreign red cell antigens through transfusion or pregnancy. In pregnant women even without the history of previous blood transfusion, this is possible through previous or current pregnancy with the presence of paternal red cell antigen inherited by the fetus. This study was aimed to determine the prevalence of red cell alloimmunisation among pregnant women without previous history of blood transfusion and the association with number of pregnancy and history of obstetric complications. This was a cross-sectional study in which 150 pregnant women were randomly selected from the antenatal clinic. Ten mls of peripheral blood was obtained for antibody screening using indirect antiglobulin test besides the routine antenatal screening. In this study, the majority (37.3%) of the women were primigravidae. Red cell alloantibodies were detected in two out of 150 (1.3%) patients which were subsequently identified as anti-C and anti-D. However none of the primigravida was alloimmunised. One woman of gravida 2 (2.9%) and gravida 3 (3.6%) each were positive for alloimmunisation. One of them also had a bad obstetric history. This study showed that the prevalence of red cell alloimmunisation among pregnant women was low in this centre. Nevertheless, red cell alloantibody screening test should be made available to reduce possible complications of alloimmunisation in mothers and fetuses.
    Study site: Antenatal clinic, Pusat Perubatan Universiti Kebangsaan Malaysia (PPUKM), Kuala Lumpur, Malaysia
    Matched MeSH terms: Blood Transfusion
  7. Ghazali, F., Jamal, R., Zakaria, S.Z., Ismail, Z.H., Malik, Y.
    MyJurnal
    The two vital aspects of treatment for patients with tha-lassaemia are regular blood transfusions and iron chela-tion therapy. Unfortunately, the use of blood transfu-sions exposes these patients to the risks of acquiring transfusion related viral infections such as hepatitis C. Patients who acquire the hepatitis C virus (HCV) may develop chronic hepatitis and later on hepatocellular carcinoma. Hence, patients with thalassaemia should be regularly screened for the presence of HCV. We report here the results of a cross-sectional study conducted in a typical day-care centre for thalassaemics at the Hospital Universiti Kebangsaan Malaysia, involving 85 multiply transfused patients. We found that 19 patients (22.4%) were seropositive for HCV and two of them had positive HCV-RNA. Those who had started receiv-ing their transfusions before 1995, i.e. the year routine screening for HCV amongst blood donors were com-menced, and those who received transfusions 2-4 week-ly had a significantly higher risk of acquiring HCV infection.
    Matched MeSH terms: Blood Transfusion
  8. Ramatillah DL, Syed Sulaiman SA, Khan AH
    J Glob Infect Dis, 2018 6 19;10(2):37-41.
    PMID: 29910562 DOI: 10.4103/jgid.jgid_85_17
    Background: According to the Association of Nephrologist in Indonesia (Pernefri) recommendation, isolation and using special hemodialysis machines are not necessary for hemodialysis (HD) patients who have been infected by hepatitis C virus (HCV), while according to the Ministry of Health Malaysia recommendation, hepatitis C patients should be dialyzed in a separate room or a separate area with a fixed partition and dedicated machines.

    Aim: The aim of this study was to identify the correlation between the recommendation which had been followed by two HD centers in different countries and the impact of that on the hepatitis C infection issue.

    Methods: A cohort prospective and retrospective study was done in this research. The study included HD patients who were followed up for 9 months and who died in the last 5 years. Universal sampling was used to select the patients based on inclusion criteria.

    Results: There was a significant relationship between HCV during the first checkup and HCV during the second checkup during the 9-month follow-up of HD patients in a HD center, Jakarta, Indonesia. The total number of patients who had hepatitis C during the first and second checkups was also different in this HD center.

    Conclusion: Besides providing special HD rooms and machines for HD patients with hepatitis C, minimizing blood transfusion to the patients on HD is also important to reduce the chance for the patients to acquire hepatitis C and to increase the percentage of survival.

    Matched MeSH terms: Blood Transfusion
  9. Mohd Faizal Mohamed Yusuf, Hafizuddin Mohamed Fauzi, Siti Salmah Noordin, Narazah Mohd Yusoff
    MyJurnal
    Dengue virus is one of the emerging agents that can be transmitted via blood transfusion from infected blood donors to recipients. In Malaysia, the increase in dengue infection may contribute to the existence of asymptomatic blood donors and increase the risk of blood supply contaminated with this virus. The aims of this study were to investigate the prevalence of NS1 dengue antigen among blood donors and to ascertain the demographic data of blood donors in Penang and and Perak. Methods: A total of 374 voluntary blood donors were recruited from two blood donation campaigns organised by Hospital Pulau Pinang, Penang and Hospital Raja Permaisuri Bainun, Ipoh, Perak from April to May 2016. From each centre, 187 voluntary blood donors were enrolled, blood was collected and Dengue NS1 Ag was screened on all the samples using Platelia dengue antigen test kit from Bio-Rad Laboratories, France. Results: All 374 samples were found to be negative for the Dengue NS1 antigen. Demographic data of these blood donors showed that the most common blood group was O Rh positive, men donated more than women and Chinese blood donors were the biggest group of donors. Conclusion: Even though dengue is endemic in Malaysia, none of the blood donors was screened positive for dengue NS1 antigen in the areas studied. This indicates that none of the blood donor at the time of donation was in viraemia stage. The established donor screening program ensures that the dengue transmission through transfusion is minimal in the areas studied.
    Matched MeSH terms: Blood Transfusion
  10. Ahmad Arif Che Ismail, Yasmin Ayob, Abdul Rahim Hussein
    MyJurnal
    CAD accounts for 25% of mortality in Malaysia public hospitals. CABG is one of treatment for patients with CAD, but requires RBC transfusion, which is associated with morbidity and mortality. This study was to evaluate the association between RBC transfusion and morbidity and mortality in CABG patients at the National Heart Centre, Malaysia (IJN). Methods: Retrospective cross-sectional study performed using data from 434 patients who underwent CABG in 2013 and 2014. Subjects had systematic random sampling every fifth subject of the patients in the sequence of dates of the year. Data related to the relationship between RBC transfusion with mortality and morbidity, and the predicting factors captured. Results: 64.3% of CABG patients (n = 279) received RBC transfusion perioperatively. Age, gender, BMI, and EF, were factors that contributed for RBC transfusion. RBC transfusion was a contributor to longer intensive care unit length of stay (ICULOS) and hospital length of stay (HLOS). Multiple logistic regression revealed, for every 1 year increase of age, there is 3.5% higher chance of transfusion. Whereas an increase of 1 kg/m2 of BMI and 1% of EF reduced the odds of RBC transfusion by 13.0% and 3.0% respectively. Conclusions: Age, gender, BMI, and EF determine the probability of needing RBC transfusion during CABG, and RBC transfusion will result in longer ICULOS, and HLOS. Probability of RBC transfusion will be higher in older patients and reduced in those with higher BMI and EF.
    Matched MeSH terms: Blood Transfusion
  11. Wong SJ, Urlings T, Seng C, Leong S, Tan BS, Tan MH
    Malays Orthop J, 2020 Mar;14(1):42-48.
    PMID: 32296481 DOI: 10.5704/MOJ.2003.007
    Introduction: The management of musculoskeletal tumours is complex and requires a multi-disciplinary approach. Preoperative embolisation can be often employed to reduce intra-operative blood loss and complication rates from surgery. We report our experience with the safety, technical success and efficacy of pre-operative embolisation in musculoskeletal tumours.

    Materials and Methods: Thirteen consecutive patients who underwent pre-operative embolisation of a musculoskeletal tumour followed by surgical intervention at our institution from May 2012 to January 2016 were enrolled into the study. Patient demographics, tumour characteristics, embolisation techniques and type of surgery were recorded. Technical success of embolisation, amount of blood loss during surgery and transfusion requirements were estimated.

    Results: There were five female and eight male patients who underwent pre-operative embolisation during the study period. The age ranged between 16 to 68 years, and the median age was 54. Technical success was achieved in all patients. Mean intra-operative blood loss was 1403ml, with a range of 150ml to 6900ml. Eight patients (62%) required intra-operative blood products of packed red blood cells and fresh frozen plasma. No major complications occurred during embolisation.

    Conclusion: Pre-operative trans-arterial embolisation is feasible and safe for a variety of large and hypervascular musculoskeletal tumours. Our small series suggests that preoperative embolisation could contribute to the reduction of the intra-operative and post-operative blood product transfusion. It should be considered as a pre-operative adjunct for major tumour resections with a high risk of bleeding. The use of the haemoglobin gap complemented the assessment of perioperative blood loss.

    Matched MeSH terms: Blood Transfusion
  12. Mohammed Abdelfatah Alhoot, Mohammed Faez Baobaid, Abdelqader MA, Lavannya Rangas Paran, Bavani Kannaiah, Kavitha Balasingam, et al.
    Dengue fever is the most common vector-borne disease and major concern issues in Malaysia. Thus, the present study aimed to evaluate factors influencing knowledge, attitude, and practices regarding dengue fever among patients in Hospital Taiping. A total of 300 patients were incorporated into a descriptive, public based cross-sectional study. The questionnaires were formulated to include several questions on demographic data, knowledge, attitudes, and practices concerning dengue fever. Most of the respondents were from the age group of more than 35 (43.3%). The largest representations of the participants were Malay (59.3%), married (65.7%), SPM is the highest education level (53.3%), and 60.7% of the participants were conscious about dengue fever eruption. Television/radio was voted as the frequent source of information (97.3%). There is no significant relationship between knowledge score and socio-demographic factors. However, around 57.0% of the respondents believe that abdominal pain is not a symptom of dengue fever and 32% convinced that blood transfusion can transmit dengue. No significant correlation was found between attitude and practice score to socio-demographic characters. However, a good practice towards dengue fever is associated with good knowledge (65.4 %) nevertheless it did not influence their attitude. Moreover, the attitude seems to be poor regardless of knowledge level (44.0%). Therefore, more prevention practices to raise the awareness of population toward dengue fever such as health campaigns and health education in school level should be initiated. These activities will aid in fertilizing better attitude and prevention practice towards dengue fever and bring down its incidence in Malaysia.
    Matched MeSH terms: Blood Transfusion
  13. Mohd Noor NH, Saad NH, Khan M, Hassan MN, Ramli M, Bahar R, et al.
    PMID: 34769712 DOI: 10.3390/ijerph182111194
    Blood transfusion is a fundamental and life-saving procedure where the consequence of errors can be fatal. Nurses' knowledge plays an essential role in ensuring quality and safety in blood transfusion. The objective of this study was to assess blood transfusion-associated knowledge of tertiary hospital nurses on the east coast of Malaysia. This was a cross-sectional study with 200 registered nurses involved in blood transfusion procedures at Hospital Universiti Sains Malaysia. The knowledge of the nurses was evaluated by using the routine blood transfusion knowledge questionnaire based on five parts, and <50%, 50-74%, or ≥75% of the knowledge was considered as poor, moderate, or high, respectively. Based on the scoring system, the overall knowledge of blood transfusion among Malaysian nurses (33.2 ± 8.4 years) was estimated to be 54.9 ± 7.6%. In individual items, the scoring was 81.0%, 45.4%, 49.2%, 63.0%, and 90.0% in knowledge prior to blood transfusion, on pre-transfusion, on post-transfusion, on complications, and on transfusion policy, respectively. The findings of this study indicated that most of the nurses' overall knowledge of blood transfusion was at a moderate level; therefore, training courses and continuous medical education are warranted to improve knowledge and skills of the nurses to ensure good practices of blood transfusion.
    Matched MeSH terms: Blood Transfusion
  14. Mihara Y, Chung WH, Chiu CK, Hasan MS, Lee SY, Ch'ng PY, et al.
    Spine (Phila Pa 1976), 2020 Mar 15;45(6):381-389.
    PMID: 31574058 DOI: 10.1097/BRS.0000000000003274
    STUDY DESIGN: Retrospective study from a prospectively collected database.

    OBJECTIVE: To compare the perioperative outcome between after-hours and daytime surgery carried out by a dedicated spinal deformity team for severe Idiopathic Scoliosis (IS) patients with Cobb angle ≥ 90°.

    SUMMARY OF BACKGROUND DATA: There were concerns that after-hours corrective surgeries in severe IS have higher morbidity compared to daytime surgeries.

    METHODS: Seventy-one severe IS patients who underwent single-staged Posterior Spinal Fusion (PSF) were included. Surgeries performed between 08:00H and 16:59H were classified as "daytime" group and surgeries performed between 17:00H and 06:00H were classified as "after-hours" group. Perioperative outcome parameters were average operation start time and end time, operation duration, intraoperative blood loss, intraoperative hemodynamic parameters, preoperative and postoperative hemoglobin, blood transfusion rate, total patient-controlled anesthesia (PCA) morphine usage, length of postoperative hospitalization, and complications. Radiological variables assessed were preoperative and postoperative Cobb angle, side bending flexibility, number of fusion levels, number of screws used, Correction Rate, and Side Bending Correction Index.

    RESULTS: Thirty patients were operated during daytime and 41 patients were operated after-hours. The mean age was 16.1 ± 5.8 years old. The mean operation start time for daytime group was 11:31 ± 2:45H versus 19:10 ± 1:24H for after-hours group. There were no significant differences between both groups in the operation duration, intraoperative blood loss, intraoperative hemodynamic parameters, postoperative hemoglobin, hemoglobin drift, transfusion rate, length of postoperative hospitalization, postoperative Cobb angle, Correction Rate, and Side Bending Correction Index. There were four complications (1 SSEP loss, 1 massive blood loss, and 2 superficial wound infections) with no difference between daytime and after-hours group.

    CONCLUSION: After-hours elective spine deformity corrective surgeries in healthy ambulatory patients with severe IS performed by a dedicated spinal deformity team using dual attending surgeon strategy were as safe as those performed during daytime.

    LEVEL OF EVIDENCE: 4.

    Matched MeSH terms: Blood Transfusion/methods; Blood Transfusion/trends
  15. Tan KK, Lee WS, Liaw LC, Oh A
    Singapore Med J, 1993 Apr;34(2):109-11.
    PMID: 8266145
    Two hundred and eleven blood transfusions were administered to 26 multi-transfused thalassemic children (aged 9 months-13 years) over a 6-month period. Eighteen children were receiving buffy coat-poor packed red cells (PRC) prepared by centrifuge while 8 children received filtered blood through a leucocyte-filter (Sepacell R-500A). Transfusion reactions occurred in 8.5% (n = 18) of transfusions and in 42.3% (n = 11) of patients. 11.9% (n = 16) and 2.6% (n = 2) of reactions occurred in 50% (n = 9) and 25% (n = 2) of patients receiving buffy coat-poor PRC and filtered blood respectively. Transfusion reactions in toto were significantly reduced in the group receiving filtered blood (p < 0.05). However, febrile reaction alone was not significantly reduced (p > 0.1). The median onset and duration of reaction were 2 hours (range 10 minutes-18 hours) and 4 hours (range 1/2-24 hours) respectively. 72.2% (n = 13) of the reactions occurred occurred during transfusion. 88.8% (n = 16) of the reactions caused only one symptom. 19.2% (n = 5) of all patients had recurrent reactions, all of them receiving buffy coat-poor PRC. The commonest clinical manifestation was fever (n = 7), followed by urticaria (n = 5) and petechial rash (n = 2). The outcome was good, with no patient experiencing symptoms exceeding 24 hours. Only 0.9% (n = 2) of the transfusions were discontinued.
    Matched MeSH terms: Blood Transfusion/adverse effects*; Blood Transfusion/methods
  16. Ayob Y
    Biologicals, 2010 Jan;38(1):91-6.
    PMID: 20133151 DOI: 10.1016/j.biologicals.2009.10.002
    Hemovigilance like quality systems and audits has become an integral part of the Blood Transfusion Service (BTS) in the developed world and has contributed greatly to the development of the blood service. However developing countries are still grappling with donor recruitment and efforts towards sufficiency and safety of the blood supply. In these countries the BTS is generally fragmented and a national hemovigilance program would be difficult to implement. However a few developing countries have an effective and sustainable blood program that can deliver equitable, safe and sufficient blood supply to the nation. Different models of hemovigilance program have been introduced with variable success. There are deficiencies but the data collected provided important information that can be presented to the health authorities for effective interventions. Hemovigilance program modeled from developed countries require expertise and resources that are not available in many developing countries. Whatever resources that are available should be utilized to correct deficiencies that are already apparent and obvious. Besides there are other tools that can be used to monitor the blood program in the developing countries depending on the need and the resources available. More importantly the data collected should be accurate and are used and taken into consideration in formulating guidelines, standards and policies and to affect appropriate interventions. Any surveillance program should be introduced in a stepwise manner as the blood transfusion service develops.
    Matched MeSH terms: Blood Transfusion/methods; Blood Transfusion/standards; Blood Transfusion/utilization*; Blood Transfusion/statistics & numerical data
  17. Tan JA, Chin SS, Ong GB, Mohamed Unni MN, Soosay AE, Gudum HR, et al.
    Public Health Genomics, 2015;18(1):60-4.
    PMID: 25412720 DOI: 10.1159/000368342
    BACKGROUND: Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak.
    METHODS: Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing.
    RESULTS: Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients.
    CONCLUSION: The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations.
    Matched MeSH terms: Blood Transfusion/methods*
  18. Ngim CF, Ng CS, Lai NM
    J Trop Pediatr, 2014 Jun;60(3):253-6.
    PMID: 24473404 DOI: 10.1093/tropej/fmu003
    A rare syndrome of hypertension, seizures and intracranial bleed has been reported among patients with congenital hemolytic anemia who underwent multiple blood transfusions. We report this syndrome in a 12-year-old Malay girl with hemoglobin E-beta-thalassemia, who underwent intensive transfusion and subsequently had headache, visual loss, severe hypertension and seizures. A comprehensive literature review revealed 30 patients with this syndrome, of whom 15 had intracranial bleed and 12 among these 15 died. A less-intensive transfusion regimen among patients with chronic hemolytic anemia and prompt detection and management of hypertension may prevent this potentially fatal syndrome.
    Matched MeSH terms: Blood Transfusion/adverse effects*
  19. Hamidah A, Arini MI, Zarina AL, Zulkifli SZ, Jamal R
    PMID: 19058587
    Growth impairment is commonly seen in children with thalassemia despite regular blood transfusions and desferrioxamine treatments. We investigated the growth velocity of 26 prepubertal patients with beta-thalassemia or HbE-beta thalassemia who were transfusion dependent aged between 2 and 13 years. The prevalence of impaired growth velocity (ie, growth velocity less than the third percentile) amongst the transfusion dependent prepubertal thalassemics was 57.7% compared to 19.2% in the control group. The mean height velocity of the thalassemics was 11.1% less than controls but this difference was not statistically significant (4.23cm/year vs 4.76cm/year, p = 0.08). The mean serum ferritin level of the thalassemics with a height < 3rd percentile was higher compared to those with a height > 3rd percentile (4,567.0 vs 2,271.0, p = 0.01). Our study showed that there was a high prevalence of impaired growth velocity amongst our transfusion dependent prepubertal thalassemics. This highlights the problem of inadequate chelation therapy, and compliance with chelation therapy amongst our patients. This study emphasizes the importance of monitoring growth parameters and optimal iron chelation therapy in these patients.
    Matched MeSH terms: Blood Transfusion/adverse effects*
  20. Chua YP, Kwan MK, Saw A
    Med J Malaysia, 2005 Jul;60 Suppl C:78-82.
    PMID: 16381289
    The need for perioperative blood transfusion in elderly patients with trochanteric fracture scheduled for elective dynamic hip screw fixation has recently been questioned following reports on the association between allogeneic blood transfusion and post-operative infections. This retrospective study was undertaken to assess the amount of per operative blood loss and transfusion requirement in relation to pre-operative haemoglobin level in 198 patients with trochanteric fractures. The average per operative blood loss was 409 ml and it correlated well with the duration of the operation. More than half of the patients (52.5%) required blood transfusion and nearly three-quarters were anaemic prior to the surgery. Proactive pre-operative measures to optimize the patient's haemoglobin level and intra-operative minimization of blood loss are essential steps to obviate the need for perioperative allogeneic blood transfusion.
    Matched MeSH terms: Blood Transfusion*
Filters
Contact Us

Please provide feedback to Administrator (afdal@afpm.org.my)

External Links