In Malaysia, Sabah population constitutes the most number of β-thalassaemia cases ranging from asymptomatic to transfusion dependent. Filipino β°-deletion has been reported as the predominant mutation in Sabah [1]. Despite having the same primary mutation, co-inheritance of genetic variants at HbF quantitative trait loci of HBS1L-MYB intergenic region may cause variability in clinical features by affecting the haemoglobin (Hb) subtypes level, especially HbF. Study suggested that MYB would activate γ-globin repressor gene directly and subsequently initiate the molecular HbF repression mechanisms. Polymorphisms within HBS1L-MYB intergenic region would inhibit binding of transcription factor on MYB and leading to elevation of HbF levels [2]. This can act as an ameliorating factor in the clinical presentation of β-thalassaemia patients [3]. This study aimed to elucidate the association of Hb subtypes levels with three HBS1L-MYB variants among 134 Filipino β°-deletion carriers. PCR-RFLP analysis was done for HBSIL-MYB rs4895441 (A→G) while tetra-primers ARMS PCR analysis was done for HBSIL-MYB rs9399137 (T→C) and rs11759553 (A→T) (Fig.1).
HbE/β-thalassaemia is a compound heterozygous mutation with a vast clinical phenotype [1]. To improve quality of life, HbE/β-thalassaemia individuals receive different treatment strategies, either individually or in combination with therapy(ies), including blood transfusion, iron chelation and splenectomy [2-3]. Thus far, there are limited studies conducted regarding the effect of treatments in HbE/β-thalassaemia individuals. We hereby investigated the effect of treatments with respect to red blood cell indices, haemoglobin subtypes and gene expressions among 30 HbE/beta-thalassaemia individuals. Statistical analyses were carried out using SPSS 17.0. As compared to single therapy (transfused only individuals) and double therapies (transfused-chelated only individuals), individuals receiving triple therapies (transfused-chelated-splenectomised individuals) showed significantly high mean cell volume (MCV), mean cell haemoglobin (MCH) and reticulocytes count (Fig.1).
These findings suggest that triple therapies are the most effective in ameliorating the severity of the disease in terms of microcytosis and hypochromia [3-5]. The high reticulocyte count in triple therapies also allows the bone marrow to actively produce red blood cells suggesting that these therapies have clinical benefits by suppressing the ineffective erythropoiesis and improving the erythropoietic environment significantly among HbE/β-thalassaemia individuals in our studied group [6-7].
The effectiveness of these treatments is different among each HbE/β-thalassaemia individual whereby clinical variabilities among them could be a contributing factor. Triple therapies giving the best advantage to the HbE/β-thalassaemia patient in this study.
Globally, α-thalassaemia is a highly prevalent disease. In Malaysia, this disorder is a well-known public health problem [1]. The three most common deletional α-thalassaemia found in this region include --SEA deletion, -α3.7 and -α4.2 deletions [2]. The prevalence rate of triplication alpha cases such as αααanti3.7 and αααanti4.2 is unknown in Malaysia although it plays a pivotal role in exacerbating the clinical phenotypes in beta thalassaemia carriers [3]. Therefore, the purpose of this study was to design an assay for the detection of triplications and common deletional alpha thalassaemia using droplet digital PCR (ddPCR). Copy number changes were analysed using Quanta-SoftTM software version 1.6.6 after performing ddPCR. Sensitivity and validation analysis were also performed on the DNA samples. The changes in copy number changes (common deletions, duplications and triplications) in the alpha globin gene has been quantitatively detected using ddPCR. For the samples validation as determined by ddPCR, the mean copy number values for αα/αα are 2.0275±0.0177 (HS-40), 1.8175±0.0389 (HBA2), 2.0450±0.0848 (HB 3.7), 2.0050±0.0000 (HBA1). For -α3.7 /--SEA, the mean copy number values are 2.0225±0.2180 (HS-40), 0.9325±0.1213 (HBA2), 0 (HB 3.7), 0.9984±0.1333 (HBA1). As for –α4.2 /--SEA, the mean copy number values are 1.9350 (HS-40), 0 (HBA2), 0.7945 (HB 3.7), 0.8480 (HBA1). The mean copy number values for --SEA/αα samples are 1.9067±0.1327 (HS-40), 0.8164±0.0364 (HBA2), 0.8920±0.0434 (HB 3.7), 0.9148±0.0338 (HBA1) respectively. This study has found that the use of ddPCR is convenient as it allows direct quantification without the requirement of a calibration curve unlike qPCR [4]. Secondly, this study also showed that ddPCR is accurate and precise in the detection of alpha thalassaemia deletions and triplications based on the gene dosages using absolute quantification. In addition, the non-requirement of post-PCR work has minimised the risk of PCR carryover contamination. Thirdly, ddPCR saves time with less turnaround time and minimise the labour work required as compared to techniques such as MLPA which requires DNA denaturation and hybridisation reaction on day 1 while ligation and PCR reaction on day 2. Fourthly, this study found that the detection of α-thalassaemia using ddPCR is sensitive. DNA samples with low concentration as low as 1 ng were able to be detected for α-thalassaemia using ddPCR. The ability to detect minute amount of DNA concentration is crucial particularly in the diagnosing of the lethal HbH hydrops foetalis during the neonatal stage in α-thalassaemia. In conclusion, this is an alternative method (ddPCR) that can be employed for rapid detection of alpha thalassaemia variants in Malaysia.
Complete blood count (CBC) is used broadly to screen individual's general health status. Some inherited red blood cell (RBC) disorders influence the RBC parameters. Mean corpuscular volume (MCV) and mean corpuscular haemoglobin (MCH) are amongst the important RBC parameters used in thalassaemia-haemoglobinopathy screening [1-2]. Globin chain disorders and Southeast Asian Ovalocytosis (SAO) are common RBC disorders in Southeast Asian countries [3]. We evaluated the RBC parameters in patients with Hb E and those with SAO co-inheritance.
A total of 33 from 1500 Malay patient’s samples that were sent for thalassaemia-haemoglobinopathies screening in Hospital Kuala Lumpur (HKL) were identified and consented (30 cases with Hb E and 3 cases with co-inheritance of Hb E and SAO). The inclusion criteria were Malay patients with MCV and MCH levels less than 78 fL and 27 pg respectively with presence of oval and stomatocytic RBCs in the peripheral blood film. DNA extraction was performed in samples suspected of having co-inheritance of SAO and Hb E. Primers 198 and 199 (AIT biotech Pte Ltd. Singapore) were designed for SAO detection [4], [5]. Hb E mutation was detected using ARMS PCR [6].
SAO was characterised by presence of an in frame 27bp deletion in exon 11 of the band 3 gene. A band of 175bp was observed in normal subjects and two bands, 175bp and 148bp were observed in heterozygous SAO subjects (Fig. 1).
Haemoglobin (Hb) Adana (HBA2:c.179>A) interacts with deletional and nondeletional α-thalassaemia mutations to produce HbH disorders with varying clinical manifestations from asymptomatic to severe anaemia with significant hepatosplenomegaly. Hb Adana carriers are generally asymptomatic and haemoglobin subtyping is unable to detect this highly unstable α-haemoglobin variant. This study identified 13 patients with compound heterozygosity for Hb Adana with either the 3.7 kb gene deletion (-α(3.7)), Hb Constant Spring (HbCS) (HBA2:c.427T>C) or Hb Paksé (HBA2:429A>T). Multiplex Amplification Refractory Mutation System was used for the detection of five deletional and six nondeletional α-thalassaemia mutations. Duplex-PCR was used to confirm Hb Paksé and HbCS. Results showed 84.6% of the Hb Adana patients were Malays. Using DNA studies, compound heterozygosity for Hb Adana and HbCS (α(codon 59)α/α(CS)α) was confirmed in 11 patients. A novel point in this investigation was that DNA studies confirmed Hb Paksé for the first time in a Malaysian patient (α(codon 59)α/α(Paksé)α) after nine years of being misdiagnosis with Hb Adana and HbCS (α(codon 59)α/α(CS)α). Thus, the reliance on haematology studies and Hb subtyping to detect Hb variants is inadequate in countries where thalassaemia is prevalent and caused by a wide spectrum of mutations.
Mesenchymal stem cells (MSCs) derived from human umbilical cord (UC) have been considered as an important tool for treating various malignancies, tissue repair and organ regeneration. Umbilical cord-derived mesenchymal stem cells (UC-MSCs) are better alternative to MSCs that derived from bone marrow (BM-MSCs) as they are regarded as medical waste with little ethical concern for research and easily culture-expanded. In this present study, the foetal distal end of human UC was utilised to generate MSC by explant method. Upon in vitro culture, adherent cells with fibroblastic morphology were generated with rapid growth kinetics. Under the respective inductive conditions, these cells were capable of differentiating into adipocytes and osteocytes; express an array of standard MSC's surface markers CD29, CD73, CD90, CD106 and MHC-class I. Further assessment of immunosuppression activity revealed that MSCs generated from UC had profoundly inhibited the proliferation of mitogen-activated T lymphocytes in a dosedependent manner. The current laboratory findings have reinforced the application of explant method to generate UCMSCs thus, exploring an ideal platform to fulfil the increasing demand of MSCs for research and potential clinical use.
The diverse clinical phenotype of hemoglobin E (HbE)/β-thalassemia has not only confounded clinicians in matters of patient management but has also led scientists to investigate the complex mechanisms involved in maintaining the delicate red cell environment where, even with apparent similarities of α- and β-globin genotypes, the phenotype tells a different story. The BTB and CNC homology 1 (BACH1) protein is known to regulate α- and β-globin gene transcriptions during the terminal differentiation of erythroid cells. With the mutations involved in HbE/β-thalassemia disorder, we studied the role of BACH1 in compensating for the globin chain imbalance, albeit for fine-tuning purposes.
BACKGROUND: The principal cause of iron overload in patients with haematological malignancies is recurrent red cell transfusions for anaemia. The serum ferritin level reflects the iron burden in the body, in the absence of inflammation or liver disease. In Malaysia, data are lacking on the association between pre-transplant serum ferritin levels and outcome after allogeneic haemopoietic stem cell transplant.
METHODS: We did a cross-sectional study using retrospective data of 106 post-allogeneic haemopoietic stem cell transplant patients (HLA-matched sibling) with haematological malignancies at Hospital Ampang to determine the relationship between pre-transplant serum ferritin levels and post-transplant outcome, post-transplant complications and survival time. Patients were divided into two groups according to the iron status: serum ferritin level >1000 μg/L (iron overload) and <1000 μg/L.
RESULTS: The median age for patients was 30.5 (18-58) years. The median pre-transplantation serum ferritin level and the prevalence of pre-transplantation iron overload were 2423 (408.2-7664) μg/L and 87.5%, respectively. No significant association was found between iron status and demographic factors, type of haematological malignancy and post-transplant complications. Although insignificant, patients with iron overload had a shorter survival time (36 months) compared to those with no iron overload (40 months). There was also no significant association between the iron status and post-transplant outcome. Significant post-transplant complications associated with post-transplant outcome were the need for total parenteral nutrition (TPN) (p=0.014) and chronic graft-versus-host disease (GVHD) (p=0.008). Similarly, significant associations were found between age group (p=0.003), TPN (p=0.035) and chronic GVHD (p=0.012) with survival time using Kaplan-Meir analysis. However, after Cox regression, only age group was found to be significantly associated with survival time (p=0.014).
CONCLUSION: Serum ferritin is an acute phase reactant and its levels increase in the presence of tissue necrosis and inflammation. Both these events occur in haematological malignancies. Although serum ferritin level is a non-invasive, relatively cost-effective, widely available and practical indicator of iron status, it is not specific to iron overload. Therefore, a true association between the serum ferritin level and iron burden is problematic in patients with haematological malignancies.
Pre-donation screening declarations and hemoglobin (Hb) testing are measures used to determine the quality of donated blood. The copper sulphate (CuSo4) method used to screen for blood abnormalities can give inaccurate results if strict quality control is not applied. Blood donors who are carriers of thalassemia and those with mild iron deficiency anemia (IDA) are usually asymptomatic and frequently missed at blood donation. The aim of this study was to evaluate the red blood cell (RBC) indices related disorders among blood donors who were deemed qualified to donate blood after screening with CuSo4 method. One hundred fifty-eight volunteer blood donors at the Universiti Putra Malaysia (UPM), who had passed the CuSo4 screening method, were recruited for this study. Their bloods specimens were examined with a complete blood count. Subjects with a low mean corpuscular hemoglobin (MCH) level were examined further by checking a serum ferritin level, Hb quantification, and molecular analysis to examine for common RBC disorders. Fourteen point six percent of subjects had a low Hb level, two (1.3%) had IDA and four (2.5%) had thalassemia or some other hemoglobinopathy. Using a MCH level < 27 pg as a cut-off point, 58 subjects (36.7%) had suspected IDA, thalassemia or some other hemoglobinopathy. Eight point nine percent of subjects with a normal Hb level had thalassemia, and 3.8% had IDA. Malaysia has a high prevalence of thalassemia and other hemoglobinopathies. Pre-donation accurate screening is crucial to protect the quality of blood transfusion products. Public education regarding RBC disorders especially among blood donors is important.
Thalassemia is known as a diverse single gene disorder, which is prevalent worldwide. The molecular chaperones are set of proteins that help in two important processes while protein synthesis and degradation include folding or unfolding and assembly or disassembly, thereby helping in cell homeostasis. This review recaps current knowledge regarding the role of molecular chaperones in thalassemia, with a focus on beta thalassemia.
BACKGROUND: Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak.
METHODS: Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing.
RESULTS: Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients.
CONCLUSION: The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations.
Homozygosity for the α-thalassaemia Southeast Asian (α-SEA) and Filipino β°-thalassaemia (β-FIL) deletions can cause serious complications leading to foetal death or life-long blood transfusions. A rapid and accurate molecular detection assay is essential in populations where the deletions are common. In this study, gap-polymerase chain reaction (PCR) with high resolution melting (HRM) analysis was developed to detect both the large deletions. Melting curves at 86.9 ± 0.1 °C were generated by normal individuals without the α-SEA deletion, 84.7 ± 0.1 °C by homozygous α-SEA deletion individuals and two melting curves at 84.7 ± 0.1 °C and 86.9 ± 0.1 °C by α-SEA deletion carriers. Normal individuals without the β-FIL deletion produce amplicons with a melting temperature (Tm) at 74.6 ± 0.1 °C, homozygous β-FIL individuals produce amplicons with Tm at 73.6 ± 0.1 °C and heterozygous β-FIL individuals generate two amplicons with Tm at 73.6 ± 0.1 °C and 74.6 ± 0.1 °C. Evaluation using blinded tests on 220 DNA samples showed 100% sensitivity and specificity. The developed assays are sensitive and specific for rapid molecular and prenatal diagnosis for the α-SEA and β-FIL deletions.
Patients with diabetes have an earlier onset and increased severity of anaemia compared to those with similar degree of renal impairment from other causes. Anaemia is associated with an increased risk of vascular complications. In this study, we determined the prevalence of anaemia in T2DM patients and its association with sociodemographic, clinical and laboratory parameters in an endocrine tertiary hospital in Malaysia. This was a cross-sectional study using retrospective electronic data from January 2011 to December 2013 of 165 T2DM patients in Hospital Putrajaya. Data was analysed using IBM SPSS Statistics version 21.0 for Windows. The prevalence of anaemia was 39.4% and majority had normocytic normochromic (80%), mild (58.5%) anaemia. Majority were Malays (73.9%), aged below 60 with comparable gender percentage and long-standing, poorly-controlled DM [median fasting blood sugar (FBS) 8mmol/L; glycated haemoglobin (HbA1c) 7.9%]. Using the KDIGO chronic kidney disease (CKD) staging system, 86% of these patients were in stages 3-5. Anaemic patients had a significantly higher serum urea, creatinine and a lower FBS, estimated glomerular filtration rate (eGFR) compared to non-anaemic patients. Anaemic patients with diabetic nephropathy had a significantly lower haemoglobin (Hb) compared to those without this complication (p=0.022). The sensitivity and specificity at a cut-off eGFR value of 38.3 ml/min/1.73 m2 (maximum Youden index = 0.462) was 66.7% and 79.5%, respectively to discriminate mild from moderate anaemia. This study shows that anaemia is already present in T2DM patients in Hospital Putrajaya at initial presentation to the specialist outpatient clinic and is significantly associated with CKD. Hence, it emphasises the obligatory need for routine and follow-up full blood count monitoring in T2DM patients in primary care as well as tertiary settings in Malaysia to enable early detection and aggressive correction of anaemia in preventing further complications.
Introduction: During the last three decades hematopoietic stem cell transplantation (HSCT) has become a well-established treatment for many hematologic malignancies. The most important limitation for HSC transplantation is the low number of hematopoietic stem cells (HSC) that can lead to delayed engraftment or graft failures. Numerous attempts have been made to improve in vitro HSC expansion via optimization of various methods such as isolation techniques, supplementing with growth factors, utilizing stromal cells as feeder layer and other culture conditions. Objective: This project is aimed to decipher the efficiency of an isolation technique and retrieval of culture expanded HSC from feeder layer using two different harvesting methods. Materials and Methods: Hematopoietic stem cells from human umbilical cord blood were isolated via MACS mediated CD34+ double sorting. Then, the cells were cultured onto MSC feeder layer for 3 and 5 days. Culture expanded cells were harvested using two different harvesting method namely cell aspiration and trypsinization methods. Hematopoietic stem cell expansion index were calculated based on harvesting methods for each time point. Results: The numbers of HSC isolated from human umbilical cord blood were 1.64 x 106 and 1.20 x106 cells at single and double sortings respectively. Although the number of sorted cells diminished at the second sorting yet the yield of CD34+ purity has increased from 43.73% at single sorting to 81.40% at double sorting. Employing the trypsinization method, the HSC harvested from feeder layer showed a significant increase in expansion index (EI) as compared to the cell aspiration harvesting method (p≤ 0.05). However, the purity of CD34+ HSC was found higher when the cells were harvested using aspiration method (82.43%) as compared to the trypsinization method (74.13%). Conclusion: A pure population of CD34+ HSC can be retrieved when the cells were double sorted using MACS and expanded in culture after being harvested using cell aspiration method.
The glycosylated haemoglobin (HbA1c) test is the most widely accepted laboratory test for evaluating long term glycaemic control. Patient’s understanding of HbA1c can lead to better glycaemic control. This study is aimed to determine the awareness and level of understanding of HbA1c among type 2 DM patients and its association with glycaemic control. A cross-sectional descriptive study among Type 2 DM patients undergoing routine follow up in an endocrine clinic of a tertiary centre in Malaysia. Patients were invited to answer a validated questionnaire which assessed their awareness and understanding of HbA1c. Their last HbA1c results were retrieved from the laboratory information system. A total of 92 participants were recruited. Fifty-six (60.9%) were aware of the term HbA1c. Fifty percent were categorised as having good HbA1c understanding, with age, monthly income and level of education being the factors associated with understanding. No significant association was noted between HbA1c understanding and glycaemic control, although more patients with good HbA1c understanding had achieved the target glycaemic control compared to those with poor understanding. The level of HbA1c awareness and understanding was acceptable. Factors associated with understanding were age, income and level of education. Continuing efforts however, must be made to improve patients understanding of their disease and clinical disease biomarkers.
Beta-thalassemia is one of the most prevalent inherited diseases and a public health problem in Malaysia. Malaysia is geographically divided into West and East Malaysia. In Sabah, a state in East Malaysia, there are over 1000 estimated cases of β-thalassemia major patients. Accurate population frequency data of the molecular basis of β-thalassemia major are needed for planning its control in the high-risk population of Sabah. Characterization of β-globin gene defects was done in 252 transfusion dependent β-thalassemia patients incorporating few PCR techniques. The study demonstrates that β-thalassemia mutations inherited are ethnically dependent. It is important to note that 86.9% of transfusion-dependent β-thalassemia major patients in Sabah were of the indigenous population and homozygous for a single mutation. The Filipino β(0)-deletion was a unique mutation found in the indigenous population of Sabah. Mutations common in West Malaysia were found in 11 (4.3%) patients. Four rare mutations (Hb Monroe, CD 8/9, CD 123/124/125 and IVS I-2) were also found. This study is informative on the population genetics of β-thalassemia major in Sabah.
Background: Diabetic retinopathy (DR) is a microvascular complication of diabetes, which is a cause of visual impairment and blindness. Its development and progression have been linked to dyslipidaemia, although the link remains inconclusive.
Aim: This study aimed to determine the prevalence of dyslipidaemia among type 2 diabetic patients with DR in a tertiary setting and to determine the association between dyslipidaemia and DR severity.
Materials and methods: This was a cross sectional study using retrospective data of type 2 diabetic patients attending the opthalmology clinic of a tertiary centre from January 2007 to June 2014. Results of their fasting lipid profile and clinical data were retrieved from the hospital information system.
Results: A total of 178 patient’s data were collected. 120 (n=67.4%) patients had non-proliferative diabetic retinopathy (NDPR) with moderate NPDR being the most prevalent. Dyslipidaemia was noted in 151 (84.8%) of the patients. Patients had a combination of more than one abnormality in the lipid profile with increased LDL-cholesterol being the main abnormality. Dyslipidaemia was however, not significantly associated with DR severity.
Conclusion: Dyslipidaemia was highly prevalent in DR patients. The dyslipidaemia was however not associated with severity of DR.
Study site: Ophthalmology clinic, Hospital (?name), Malaysia
Mesenchymal stem cells (MSC) generated from human umbilical cord (UC-MSC) and placenta (PLC-MSC) were assessed and compared for their immunomodulatory function on T cells proliferation by analysis of the cell cycle. Mitogen stimulated or resting T cells were co-cultured in the presence or absence of MSC. T-cell proliferation was assessed by tritiated thymidine ((3) H-TdR) assay and the mechanism of inhibition was examined bycell cycle and apoptosis assay. Both UC-MSC and PLC-MSC profoundly inhibited the proliferation of T-cell, mainly via cell-to-cell contact. MSC-mediated anti-proliferation does not lead to apoptosis,but prevented T cells from entering S phase and they therefore accumulated in the G(0) /G(1) phases. The anti-proliferative activity of MSC was related to this cell cycle arrest of T-cell. UC-MSC produced a greater inhibition than PLC-MSC in all measured parameters.
β-Thalassemia is a public health problem where 4.5% of Malaysians are β-thalassemia carriers. The genetic disorder is caused by defects in the β-globin gene complex which lead to reduced or complete absence of β-globin chain synthesis. Five TaqMan genotyping assays were designed and developed to detect the common β-thalassemia mutations in Malaysian Malays. The assays were evaluated with 219 "blinded" DNA samples and the results showed 100% sensitivity and specificity. The in-house designed TaqMan genotyping assays were found to be cost- and time-effective for characterization of β-thalassemia mutations in the Malaysian population.