Displaying publications 1 - 20 of 34 in total

Abstract:
Sort:
  1. Fulltext Generation and characterisation of human umbilical cord derived mesenchymal stem cells by explant method
    Yusoff Z, Maqbool M, George E, Hassan R, Ramasamy R
    Med J Malaysia, 2016 Jun;71(3):105-10.
    PMID: 27495882 MyJurnal
    Mesenchymal stem cells (MSCs) derived from human umbilical cord (UC) have been considered as an important tool for treating various malignancies, tissue repair and organ regeneration. Umbilical cord-derived mesenchymal stem cells (UC-MSCs) are better alternative to MSCs that derived from bone marrow (BM-MSCs) as they are regarded as medical waste with little ethical concern for research and easily culture-expanded. In this present study, the foetal distal end of human UC was utilised to generate MSC by explant method. Upon in vitro culture, adherent cells with fibroblastic morphology were generated with rapid growth kinetics. Under the respective inductive conditions, these cells were capable of differentiating into adipocytes and osteocytes; express an array of standard MSC's surface markers CD29, CD73, CD90, CD106 and MHC-class I. Further assessment of immunosuppression activity revealed that MSCs generated from UC had profoundly inhibited the proliferation of mitogen-activated T lymphocytes in a dosedependent manner. The current laboratory findings have reinforced the application of explant method to generate UCMSCs thus, exploring an ideal platform to fulfil the increasing demand of MSCs for research and potential clinical use.
  2. Fulltext Molecular characterisation and frequency of Ggamma Xmn I polymorphism in Chinese and Malay beta-thalassaemia patients in Malaysia
    Wong YC, George E, Tan KL, Yap SF, Chan LL, Tan JA
    Malays J Pathol, 2006 Jun;28(1):17-21.
    PMID: 17694955
    The molecular basis of variable phenotypes in P-thalassaemia patients with identical genotypes has been associated with co-inheritance of alpha-thalassaemia and persistence of HbF production in adult life. The Xmn I restriction site at -158 position of the Ggamma-gene is associated with increased expression of the Ggamma-globin gene and higher production of HbF This study aims to determine the frequency of the digammaferent genotypes of the Ggamma Xmn I polymorphism in P-thalassaemia patients in two ethnic groups in Malaysia. Molecular characterisation and frequency of the Ggamma Xmn I polymorphism were studied in fifty-eight Chinese and forty-nine beta-thalassaemia Malay patients by Xmn I digestion after DNA amplification of a 650 bp sequence. The in-house developed technique did not require further purification or concentration of amplified DNA before restriction enzyme digestion. The cheaper Seakem LE agarose was used instead of Nusieve agarose and distinct well separated bands were observed. Genotyping showed that the most frequent genotype observed in the Malaysian Chinese was homozygosity for the absence of the Xmn I site (-/-) (89.7%). In the Malays, heterozygosity of the Xmn I site (+/-) was most common (63.3%). Homozygosity for the Xmn I site (+/+) was absent in the Chinese, but was confirmed in 8.2% of the Malays. The ratio of the (+) allele (presence of the Xmn I site) to the (-) allele (absence of the Xmn I site)) was higher in the Malays (0.66) compared to the Chinese (0.05). The (+/-) and (+/+) genotypes are more commonly observed in the Malays than the Chinese in Malaysia.
  3. Fulltext Public perceptions and attitudes toward thalassaemia: Influencing factors in a multi-racial population
    Wong LP, George E, Tan JA
    BMC Public Health, 2011;11:193.
    PMID: 21447191 DOI: 10.1186/1471-2458-11-193
    Thalassaemia is a common public health problem in Malaysia and about 4.5 to 6% of the Malays and Chinese are carriers of this genetic disorder. The major forms of thalassaemia result in death in utero of affected foetuses (α-thalassaemia) or life-long blood transfusions for survival in β-thalassaemia. This study, the first nationwide population based survey of thalassaemia in Malaysia, aimed to determine differences in public awareness, perceptions and attitudes toward thalassaemia in the multi-racial population in Malaysia.
  4. Fulltext A holistic approach to education programs in thalassemia for a multi-ethnic population: consideration of perspectives, attitudes, and perceived needs
    Wong LP, George E, Tan JA
    J Community Genet, 2011 Jun;2(2):71-9.
    PMID: 22109791 DOI: 10.1007/s12687-011-0039-z
    Hemoglobin disorders which include thalassemias are the most common heritable disorders. Effective treatment is available, and these disorders can be avoided as identification of carriers is achievable using simple hematological tests. An in-depth understanding of the awareness, attitudes, perceptions, and screening reservations towards thalassemia is necessary, as Malaysia has a multi-ethnic population with different religious beliefs. A total of 13 focus group discussions (70 participants) with members of the general lay public were conducted between November 2008 and January 2009. Lack of knowledge and understanding about thalassemia leads to general confusions over differences between thalassemia carriers and thalassemia major, inheritance patterns, and the physical and psychologically impact of the disorder in affected individuals and their families. Although most of the participants have not been tested for thalassemia, a large majority expressed willingness to be screened. Views on prenatal diagnosis and termination of fetuses with thalassemia major received mixed opinions from participants with different religions and practices. Perceived stigma and discrimination attached to being a carrier emerged as a vital topic in some group discussions where disparity in the answers exhibited differences in levels of participants' literacy and ethnic origins. The two most common needs identified from the discussion were information and screening facilities. Participants' interest in knowing the severity of the disease and assessing their risk of getting the disorder may imply the health belief model as a possible means of predicting thalassemia public screening services. Findings provide valuable insights for the development of more effective educational, screening, and prenatal diagnostic services in the multi-ethnic Asian society.
  5. Fulltext Molecular characterisation of Haemoglobin Constant Spring and Haemoglobin Quong Sze with a Combine-Amplification Refractory Mutation System
    Wee YC, Tan KL, Chua KH, George E, Tan JA
    Malays J Med Sci, 2009 Jul;16(3):21-8.
    PMID: 22589661 MyJurnal
    BACKGROUND: The interaction of the non-deletional α(+)-thalassaemia mutations Haemoglobin Constant Spring and Haemoglobin Quong Sze with the Southeast Asian double α-globin gene deletion results in non-deletional Haemoglobin H disease. Accurate detection of non-deletional Haemoglobin H disease, which is associated with severe phenotypes, is necessary as these mutations have been confirmed in the Malaysian population.
    METHODS: DNA from two families with Haemoglobin H disease was extracted from EDTA-anticoagulated whole blood and subjected to molecular analysis for α-thalassaemia. A duplex polymerase chain reaction was used to detect the Southeast Asian α-globin gene deletion. Polymerase chain reaction-restriction fragment length polymorphism analysis was then carried out to determine the presence of Haemoglobin Constant Spring and Haemoglobin Quong Sze. A combine-amplification refractory mutation system protocol was optimised and implemented for the rapid and specific molecular characterisation of Haemoglobin Constant Spring and Haemoglobin Quong Sze in a single polymerase chain reaction.
    RESULTS AND CONCLUSIONS: The combine-amplification refractory mutation system for Haemoglobin Constant Spring and Haemoglobin Quong Sze, together with the duplex polymerase chain reaction, provides accurate pre- and postnatal diagnosis of non-deletional Haemoglobin H disease and allows detailed genotype analyses using minimal quantities of DNA.
    KEYWORDS: Combine-ARMS; Hb Constant Spring; Hb Quong Sze; medical sciences
  6. Isolation and characterisation of mesenchymal stem cells derived from human placenta tissue
    Vellasamy S, Sandrasaigaran P, Vidyadaran S, George E, Ramasamy R
    World J Stem Cells, 2012 Jun 26;4(6):53-61.
    PMID: 22993662
    To explore the feasibility of placenta tissue as a reliable and efficient source for generating mesenchymal stem cells (MSC).
  7. Mesenchymal stem cells of human placenta and umbilical cord suppress T-cell proliferation at G0 phase of cell cycle
    Vellasamy S, Sandrasaigaran P, Vidyadaran S, Abdullah M, George E, Ramasamy R
    Cell Biol Int, 2013 Mar;37(3):250-6.
    PMID: 23364902 DOI: 10.1002/cbin.10033
    Mesenchymal stem cells (MSC) generated from human umbilical cord (UC-MSC) and placenta (PLC-MSC) were assessed and compared for their immunomodulatory function on T cells proliferation by analysis of the cell cycle. Mitogen stimulated or resting T cells were co-cultured in the presence or absence of MSC. T-cell proliferation was assessed by tritiated thymidine ((3) H-TdR) assay and the mechanism of inhibition was examined bycell cycle and apoptosis assay. Both UC-MSC and PLC-MSC profoundly inhibited the proliferation of T-cell, mainly via cell-to-cell contact. MSC-mediated anti-proliferation does not lead to apoptosis,but prevented T cells from entering S phase and they therefore accumulated in the G(0) /G(1) phases. The anti-proliferative activity of MSC was related to this cell cycle arrest of T-cell. UC-MSC produced a greater inhibition than PLC-MSC in all measured parameters.
  8. Fulltext Pre-transplantation serum ferritin as a prognostic marker in allogeneic haemopoietic stem cell transplant patients in a tertiary care hospital in Malaysia
    Thambiah SC, George E, Samsudin IN, Hong LH, Chuo LL, Ramli N, et al.
    Natl Med J India, 2016 May-Jun;29(3):136-140.
    PMID: 27808061
    BACKGROUND: The principal cause of iron overload in patients with haematological malignancies is recurrent red cell transfusions for anaemia. The serum ferritin level reflects the iron burden in the body, in the absence of inflammation or liver disease. In Malaysia, data are lacking on the association between pre-transplant serum ferritin levels and outcome after allogeneic haemopoietic stem cell transplant.

    METHODS: We did a cross-sectional study using retrospective data of 106 post-allogeneic haemopoietic stem cell transplant patients (HLA-matched sibling) with haematological malignancies at Hospital Ampang to determine the relationship between pre-transplant serum ferritin levels and post-transplant outcome, post-transplant complications and survival time. Patients were divided into two groups according to the iron status: serum ferritin level >1000 μg/L (iron overload) and <1000 μg/L.

    RESULTS: The median age for patients was 30.5 (18-58) years. The median pre-transplantation serum ferritin level and the prevalence of pre-transplantation iron overload were 2423 (408.2-7664) μg/L and 87.5%, respectively. No significant association was found between iron status and demographic factors, type of haematological malignancy and post-transplant complications. Although insignificant, patients with iron overload had a shorter survival time (36 months) compared to those with no iron overload (40 months). There was also no significant association between the iron status and post-transplant outcome. Significant post-transplant complications associated with post-transplant outcome were the need for total parenteral nutrition (TPN) (p=0.014) and chronic graft-versus-host disease (GVHD) (p=0.008). Similarly, significant associations were found between age group (p=0.003), TPN (p=0.035) and chronic GVHD (p=0.012) with survival time using Kaplan-Meir analysis. However, after Cox regression, only age group was found to be significantly associated with survival time (p=0.014).

    CONCLUSION: Serum ferritin is an acute phase reactant and its levels increase in the presence of tissue necrosis and inflammation. Both these events occur in haematological malignancies. Although serum ferritin level is a non-invasive, relatively cost-effective, widely available and practical indicator of iron status, it is not specific to iron overload. Therefore, a true association between the serum ferritin level and iron burden is problematic in patients with haematological malignancies.
  9. Fulltext Anaemia in type 2 diabetes mellitus (T2DM) patients in Hospital Putrajaya
    Thambiah CS, Samsudin IN, George E, Ranjit LK, Saat NS, Hussein Z, et al.
    Malaysian Journal of Medicine and Health Sciences, 2015;11(1):49-62.
    MyJurnal
    Patients with diabetes have an earlier onset and increased severity of anaemia compared to those with similar degree of renal impairment from other causes. Anaemia is associated with an increased risk of vascular complications. In this study, we determined the prevalence of anaemia in T2DM patients and its association with sociodemographic, clinical and laboratory parameters in an endocrine tertiary hospital in Malaysia. This was a cross-sectional study using retrospective electronic data from January 2011 to December 2013 of 165 T2DM patients in Hospital Putrajaya. Data was analysed using IBM SPSS Statistics version 21.0 for Windows. The prevalence of anaemia was 39.4% and majority had normocytic normochromic (80%), mild (58.5%) anaemia. Majority were Malays (73.9%), aged below 60 with comparable gender percentage and long-standing, poorly-controlled DM [median fasting blood sugar (FBS) 8mmol/L; glycated haemoglobin (HbA1c) 7.9%]. Using the KDIGO chronic kidney disease (CKD) staging system, 86% of these patients were in stages 3-5. Anaemic patients had a significantly higher serum urea, creatinine and a lower FBS, estimated glomerular filtration rate (eGFR) compared to non-anaemic patients. Anaemic patients with diabetic nephropathy had a significantly lower haemoglobin (Hb) compared to those without this complication (p=0.022). The sensitivity and specificity at a cut-off eGFR value of 38.3 ml/min/1.73 m2 (maximum Youden index = 0.462) was 66.7% and 79.5%, respectively to discriminate mild from moderate anaemia. This study shows that anaemia is already present in T2DM patients in Hospital Putrajaya at initial presentation to the specialist outpatient clinic and is significantly associated with CKD. Hence, it emphasises the obligatory need for routine and follow-up full blood count monitoring in T2DM patients in primary care as well as tertiary settings in Malaysia to enable early detection and aggressive correction of anaemia in preventing further complications.

    Study site: endocrine clinic, Hospital Putrajaya
  10. Molecular basis of transfusion dependent beta-thalassemia major patients in Sabah
    Teh LK, George E, Lai MI, Tan JA, Wong L, Ismail P
    J Hum Genet, 2014 Mar;59(3):119-23.
    PMID: 24369358 DOI: 10.1038/jhg.2013.131
    Beta-thalassemia is one of the most prevalent inherited diseases and a public health problem in Malaysia. Malaysia is geographically divided into West and East Malaysia. In Sabah, a state in East Malaysia, there are over 1000 estimated cases of β-thalassemia major patients. Accurate population frequency data of the molecular basis of β-thalassemia major are needed for planning its control in the high-risk population of Sabah. Characterization of β-globin gene defects was done in 252 transfusion dependent β-thalassemia patients incorporating few PCR techniques. The study demonstrates that β-thalassemia mutations inherited are ethnically dependent. It is important to note that 86.9% of transfusion-dependent β-thalassemia major patients in Sabah were of the indigenous population and homozygous for a single mutation. The Filipino β(0)-deletion was a unique mutation found in the indigenous population of Sabah. Mutations common in West Malaysia were found in 11 (4.3%) patients. Four rare mutations (Hb Monroe, CD 8/9, CD 123/124/125 and IVS I-2) were also found. This study is informative on the population genetics of β-thalassemia major in Sabah.
  11. Transfusion-dependent thalassemia in Northern Sarawak: a molecular study to identify different genotypes in the multi-ethnic groups and the importance of genomic sequencing in unstudied populations
    Tan JA, Chin SS, Ong GB, Mohamed Unni MN, Soosay AE, Gudum HR, et al.
    Public Health Genomics, 2015;18(1):60-4.
    PMID: 25412720 DOI: 10.1159/000368342
    BACKGROUND: Although thalassemia is a genetic hemoglobinopathy in Malaysia, there is limited data on thalassemia mutations in the indigenous groups. This study aims to identify the types of globin gene mutations in transfusion-dependent patients in Northern Sarawak.
    METHODS: Blood was collected from 32 patients from the Malay, Chinese, Kedayan, Bisayah, Kadazandusun, Tagal, and Bugis populations. The α- and β-globin gene mutations were characterized using DNA amplification and genomic sequencing.
    RESULTS: Ten β- and 2 previously reported α-globin defects were identified. The Filipino β-deletion represented the majority of the β-thalassemia alleles in the indigenous patients. Homozygosity for the deletion was observed in all Bisayah, Kadazandusun and Tagal patients. The β-globin gene mutations in the Chinese patients were similar to the Chinese in West Malaysia. Hb Adana (HBA2:c.179G>A) and the -α(3.7)/αα deletion were detected in 5 patients. A novel 24-bp deletion in the α2-globin gene (HBA2:c.95 + 5_95 + 28delGGCTCCCTCCCCTGCTCCGACCCG) was identified by sequencing. Co-inheritance of α-thalassemia with β-thalassemia did not ameliorate the severity of thalassemia major in the patients.
    CONCLUSION: The Filipino β-deletion was the most common gene defect observed. Homozygosity for the Filipino β-deletion appears to be unique to the Malays in Sarawak. Genomic sequencing is an essential tool to detect rare genetic variants in the study of new populations.
  12. Fulltext DNA studies are necessary for accurate patient diagnosis in compound heterozygosity for Hb Adana (HBA2:c.179>A) with deletional or nondeletional α-thalassaemia
    Tan JA, Kho SL, Ngim CF, Chua KH, Goh AS, Yeoh SL, et al.
    Sci Rep, 2016 06 08;6:26994.
    PMID: 27271331 DOI: 10.1038/srep26994
    Haemoglobin (Hb) Adana (HBA2:c.179>A) interacts with deletional and nondeletional α-thalassaemia mutations to produce HbH disorders with varying clinical manifestations from asymptomatic to severe anaemia with significant hepatosplenomegaly. Hb Adana carriers are generally asymptomatic and haemoglobin subtyping is unable to detect this highly unstable α-haemoglobin variant. This study identified 13 patients with compound heterozygosity for Hb Adana with either the 3.7 kb gene deletion (-α(3.7)), Hb Constant Spring (HbCS) (HBA2:c.427T>C) or Hb Paksé (HBA2:429A>T). Multiplex Amplification Refractory Mutation System was used for the detection of five deletional and six nondeletional α-thalassaemia mutations. Duplex-PCR was used to confirm Hb Paksé and HbCS. Results showed 84.6% of the Hb Adana patients were Malays. Using DNA studies, compound heterozygosity for Hb Adana and HbCS (α(codon 59)α/α(CS)α) was confirmed in 11 patients. A novel point in this investigation was that DNA studies confirmed Hb Paksé for the first time in a Malaysian patient (α(codon 59)α/α(Paksé)α) after nine years of being misdiagnosis with Hb Adana and HbCS (α(codon 59)α/α(CS)α). Thus, the reliance on haematology studies and Hb subtyping to detect Hb variants is inadequate in countries where thalassaemia is prevalent and caused by a wide spectrum of mutations.
  13. Interaction of Hb South Florida (codon 1; GTG-->ATG) and HbE, with beta-thalassemia (IVS1-1; G-->A): expression of different clinical phenotypes
    Tan JA, Tan KL, Omar KZ, Chan LL, Wee YC, George E
    Eur J Pediatr, 2009 Sep;168(9):1049-54.
    PMID: 19034506 DOI: 10.1007/s00431-008-0877-9
    INTRODUCTION: Interactions of different hemoglobin variants with thalassemia alleles can result in various clinical phenotypes. HbE-beta-thalassemia generally manifests with severe anemia where individuals exhibit beta-thalassemia major with regular blood transfusions or beta-thalassemia intermedia with periodic blood transfusions. This study presents a unique Malay family with three beta-globin gene defects-HbE, Hb South Florida, and IVS1-1 (G-->A).

    MATERIALS AND METHODS: HbE activates a cryptic splice site that produces non-functional mRNAs. Hb South Florida is a rare beta-hemoglobin variant, and its interactions with other beta-thalassemia alleles have not been reported. IVS1-1 is a Mediterranean mutation that affects mRNA processing giving rise to beta(o)-thalassemia.

    RESULTS AND DISCUSSION: Fifteen mutations along the beta-globin gene complex were analyzed using the amplification refractory mutation system. Hb South Florida was identified by direct sequencing using genomic DNA.

    CONCLUSION: The affected child with HbE/IVS1-1 produced a beta-thalassemia major phenotype. Compound heterozygosity for Hb South Florida/IVS1-1 produced a beta-thalassemia carrier phenotype in the mother.

  14. Characterisation and confirmation of rare beta-thalassaemia mutations in the Malay, Chinese and Indian ethnic groups in Malaysia
    Tan JA, Chin PS, Wong YC, Tan KL, Chan LL, George E
    Pathology, 2006 Oct;38(5):437-41.
    PMID: 17008283
    In Malaysia, about 4.5% of the Malay and Chinese populations are heterozygous carriers of beta-thalassaemia. The initial identification of rare beta-globin gene mutations by genomic sequencing will allow the development of simpler and cost-effective PCR-based techniques to complement the existing amplification refractory mutation system (ARMS) and gap-PCR used for the identification of beta-thalassaemia mutations.
  15. Thalassemia intermedia in HbH-CS disease with compound heterozygosity for beta-thalassemia: challenges in hemoglobin analysis and clinical diagnosis
    Tan JA, Kok JL, Tan KL, Wee YC, George E
    Genes Genet Syst, 2009 Feb;84(1):67-71.
    PMID: 19420802
    Co-inheritance of alpha-thalassemia with homozygosity or compound heterozygosity for beta-thalassemia may ameliorate beta-thalassemia major. A wide range of clinical phenotypes is produced depending on the number of alpha-thalassemia alleles (-alpha/alphaalpha --/alphaalpha, --/-alpha). The co-inheritance of beta-thalassemia with alpha-thalassemia with a single gene deletion (-alpha/alphaalpha) is usually associated with thalassemia major. In contrast, the co-inheritance of beta-thalassemia with two alpha-genes deleted in cis or trans (--/alphaalpha or -alpha/-alpha) generally produces beta-thalassemia intermedia. In Southeast Asia, the most common defect responsible for alpha-thalassemia is the Southeast Asian (SEA) deletion of 20.5 kilobases. The presence of the SEA deletion with Hb Constant Spring (HbCS) produces HbH-CS disease. Co-inheritance of HbH-CS with compound heterozygosity for beta-thalassemia is very rare. This study presents a Malay patient with HbH-CS disorder and beta degrees/beta+-thalassemia. The SEA deletion was confirmed in the patient using a duplex-PCR. A Combine-Amplification Refractory Mutation System (C-ARMS) technique to simultaneously detect HbCS and Hb Quong Sze confirmed HbCS in the patient. Compound heterozygosity for CD41/42 and Poly A was confirmed using the ARMS. This is a unique case as the SEA alpha-gene deletion in cis (--SEA/alphaalpha) is generally not present in the Malays, who more commonly possess the two alpha-gene deletion in trans (-alpha/-alpha). In addition, the beta-globin gene mutation at CD41/42 is a common mutation in the Chinese and not in the Malays. The presence of both the SEA deletion and CD41/42 in the mother of the patient suggests the possible introduction of these two defects into the family by marriage with a Chinese.
  16. Fulltext High prevalence of alpha- and beta-thalassemia in the Kadazandusuns in East Malaysia: challenges in providing effective health care for an indigenous group
    Tan JA, Lee PC, Wee YC, Tan KL, Mahali NF, George E, et al.
    J Biomed Biotechnol, 2010;2010.
    PMID: 20871816 DOI: 10.1155/2010/706872
    Thalassemia can lead to severe transfusion-dependent anemia, and it is the most common genetic disorder in Malaysia. This paper aims to determine the prevalence of thalassemia in the Kadazandusuns, the largest indigenous group in Sabah, East Malaysia. α- and β-thalassemia were confirmed in 33.6% and 12.8%, of the individuals studied respectively. The high prevalence of α- and β-thalassemia in the Kadazandusuns indicates that thalassemia screening, genetic counseling, and prenatal diagnosis should be included as part of their healthcare system. This preliminary paper serves as a baseline for further investigations into the health and genetic defects of the major indigenous population in Sabah, East Malaysia.
  17. Review: Beta-thalassemia and molecular chaperones
    Sumera A, Radhakrishnan A, Baba AA, George E
    Blood Cells Mol. Dis., 2015 Apr;54(4):348-52.
    PMID: 25648458 DOI: 10.1016/j.bcmd.2015.01.008
    Thalassemia is known as a diverse single gene disorder, which is prevalent worldwide. The molecular chaperones are set of proteins that help in two important processes while protein synthesis and degradation include folding or unfolding and assembly or disassembly, thereby helping in cell homeostasis. This review recaps current knowledge regarding the role of molecular chaperones in thalassemia, with a focus on beta thalassemia.
  18. Fulltext Prevalence of dyslipidaemia in type 2 diabetes mellitus patients and Its association to diabetic retinopathy in a Malaysian tertiary hospital
    Samsudin IN, Md Saleh R, Thambiah SC, Mohamad Amir Hamzah AS, Wan Khalik WNF, George E
    Malaysian Journal of Medicine and Health Sciences, 2014;10(2):47-51.
    MyJurnal
    Background: Diabetic retinopathy (DR) is a microvascular complication of diabetes, which is a cause of visual impairment and blindness. Its development and progression have been linked to dyslipidaemia, although the link remains inconclusive.
    Aim: This study aimed to determine the prevalence of dyslipidaemia among type 2 diabetic patients with DR in a tertiary setting and to determine the association between dyslipidaemia and DR severity.
    Materials and methods: This was a cross sectional study using retrospective data of type 2 diabetic patients attending the opthalmology clinic of a tertiary centre from January 2007 to June 2014. Results of their fasting lipid profile and clinical data were retrieved from the hospital information system.
    Results: A total of 178 patient’s data were collected. 120 (n=67.4%) patients had non-proliferative diabetic retinopathy (NDPR) with moderate NPDR being the most prevalent. Dyslipidaemia was noted in 151 (84.8%) of the patients. Patients had a combination of more than one abnormality in the lipid profile with increased LDL-cholesterol being the main abnormality. Dyslipidaemia was however, not significantly associated with DR severity.
    Conclusion: Dyslipidaemia was highly prevalent in DR patients. The dyslipidaemia was however not associated with severity of DR.
    Study site: Ophthalmology clinic, Hospital (?name), Malaysia
  19. Fulltext Co-inheritance of Southeast Asian ovalocytosis and Hb e: does it affect the red blood cells indices?
    Riahi, Shahrzard, Mei, I Lai, George, Elizabeth, Ida Marhainis Isahak, Faridah Idris, Sabariah Md Noor
    Journal of Biomedical and Clinical Sciences, 2017;2(202):44-46.
    MyJurnal
    Complete blood count (CBC) is used broadly to screen individual's general health status. Some inherited red blood cell (RBC) disorders influence the RBC parameters. Mean corpuscular volume (MCV) and mean corpuscular haemoglobin (MCH) are amongst the important RBC parameters used in thalassaemia-haemoglobinopathy screening [1-2]. Globin chain disorders and Southeast Asian Ovalocytosis (SAO) are common RBC disorders in Southeast Asian countries [3]. We evaluated the RBC parameters in patients with Hb E and those with SAO co-inheritance.

    A total of 33 from 1500 Malay patient’s samples that were sent for thalassaemia-haemoglobinopathies screening in Hospital Kuala Lumpur (HKL) were identified and consented (30 cases with Hb E and 3 cases with co-inheritance of Hb E and SAO). The inclusion criteria were Malay patients with MCV and MCH levels less than 78 fL and 27 pg respectively with presence of oval and stomatocytic RBCs in the peripheral blood film. DNA extraction was performed in samples suspected of having co-inheritance of SAO and Hb E. Primers 198 and 199 (AIT biotech Pte Ltd. Singapore) were designed for SAO detection [4], [5]. Hb E mutation was detected using ARMS PCR [6].

    SAO was characterised by presence of an in frame 27bp deletion in exon 11 of the band 3 gene. A band of 175bp was observed in normal subjects and two bands, 175bp and 148bp were observed in heterozygous SAO subjects (Fig. 1).
  20. Fulltext Evaluation of red blood cell indices related disorders among eligible blood donors at the Universiti Putra Malaysia (UPM)
    Riahi S, Mei IL, Idris FB, George E, Noor SM
    Southeast Asian J. Trop. Med. Public Health, 2015 Sep;46(5):911-7.
    PMID: 26863862
    Pre-donation screening declarations and hemoglobin (Hb) testing are measures used to determine the quality of donated blood. The copper sulphate (CuSo4) method used to screen for blood abnormalities can give inaccurate results if strict quality control is not applied. Blood donors who are carriers of thalassemia and those with mild iron deficiency anemia (IDA) are usually asymptomatic and frequently missed at blood donation. The aim of this study was to evaluate the red blood cell (RBC) indices related disorders among blood donors who were deemed qualified to donate blood after screening with CuSo4 method. One hundred fifty-eight volunteer blood donors at the Universiti Putra Malaysia (UPM), who had passed the CuSo4 screening method, were recruited for this study. Their bloods specimens were examined with a complete blood count. Subjects with a low mean corpuscular hemoglobin (MCH) level were examined further by checking a serum ferritin level, Hb quantification, and molecular analysis to examine for common RBC disorders. Fourteen point six percent of subjects had a low Hb level, two (1.3%) had IDA and four (2.5%) had thalassemia or some other hemoglobinopathy. Using a MCH level < 27 pg as a cut-off point, 58 subjects (36.7%) had suspected IDA, thalassemia or some other hemoglobinopathy. Eight point nine percent of subjects with a normal Hb level had thalassemia, and 3.8% had IDA. Malaysia has a high prevalence of thalassemia and other hemoglobinopathies. Pre-donation accurate screening is crucial to protect the quality of blood transfusion products. Public education regarding RBC disorders especially among blood donors is important.
Related Terms
Filters
Contact Us

Please provide feedback to Administrator (afdal@afpm.org.my)

External Links